===== PAGE 1 ===== ## Proceedings of the SAP 2015 Summer Apprenticeship Program
Image
Image
===== PAGE 2 ===== July 2015 # Proceedings of the Kentucky State University 2015 Summer Apprenticeship Program Editors: Dr. Buddhi Gyawali Jeremy Sandifer ===== PAGE 3 ===== # Proceedings of the Kentucky State University Summer Apprenticeship Program Editors: Dr. Buddhi Gyawali Jeremy Sandifer Summer Apprenticeship Program Kentucky State University College of Agriculture, Food Science and Sustainable Systems Frankfort, Kentucky 40601 July 2015 (Document Last Revised October 2015) ===== PAGE 4 ===== ## Forward Kentucky State University organized a 3-week long Summer Apprenticeship Program (SAP) from June 7-27, 2015 to introduce rising high school students to the fields of Science, Technology, Engineering, and Mathematics (STEM) including agricultural, environmental and geospatial related disciplines. The program was designed to prepare them for college programs and careers in STEM field through hands-on experiential learning, research, and college-prep projects. Twenty-nine students from 25 high schools participated in the program. The Proceedings of the Summer Apprenticeship Program consists of 22 scientific research papers in the areas of Agriculture and Food Sciences, Aquaculture, Behavioral and Social Sciences, Molecular Biology, Computer Sciences, and Geographic Information Sciences submitted in fulfillment of the requirements of the SAP program curriculum. As part of the experience, students undertook intensive research projects lasting two weeks that culminated with oral presentations delivered during the program closing ceremony with all student program participants, research mentors, student families, and KSU leadership in attendance. The SAP organizing committee would like to thank all the mentors who provided invaluable assistance and time to the apprentices for conducting experiential research and preparing scientific reports. We would like to extend our deep appreciation to Dr. Kirk Pomper, Interim Director of KSU Land Grant Programs and Ms. Blair Thomas Hess, Media and Communications Manager, for reviewing the SAP Proceeding and administrative support. Finally, we would like to thank the National Science Foundation Historically Black College and Universities-Undergraduate Program (NSF-HBCU-UP Award # HRD-1332477 & HRD-1436426), and the United States Department of Agriculture-Capacity Building Grant (USDA-CBG Award # 2013-38821-21120 for providing funding supports to the SAP program. Dr. Buddhi Gyawali, SAP Director Jeremy Sandifer, STEM-Project Director ===== PAGE 5 ===== Table of Contents FORWARD.....IV AGRICULTURE AND FOOD SCIENCES.....1 GRAFTING SUCCESS ON AMERICAN PAWPAW (ASIMINA-TRILOBA) USING CHIP BUD AND WHIP AND TONGUE GRAFTS.....2 CAN ORNAMENTAL PLANTS BE PROPAGATED IN 10 DAYS?.....5 DETERMINATION OF CAPSAICIN IN HOT PEPPERS.....8 MEALWORMS WITH A PURPOSE.....11 LADY BEETLES IN NATIVE PERENNIAL PLANTINGS WITHIN CENTRAL KENTUCKY.....14 AQUACULTURE SCIENCES.....18 FISH DISEASE.....19 ACUTE TOXICITY OF TOTAL AMMONIA-NITROGEN TO LARVAE OF THE AFRICAN RIVER PRAWN.....21 OPTIMIZING THE USE OF ALGAL MEAL (SCHIZOCHYTRIUM SP.) AS A FISH OIL REPLACER IN PACIFIC WHITE SHRIMP (LITOPENAEUS VANNAMEI).....24 INTERDISCIPLINARY BEHAVIORAL AND SOCIAL SCIENCES.....32 VOICES I.....33 VOICES II.....37 MOLECULAR BIOLOGY.....41 USING POLYMERASE CHAIN REACTION TO IDENTIFY COMPONENTS OF UNKNOWN MEAT SAMPLES.....42 COMPUTER SCIENCES.....46 GRAPHICS SCENE MODELING AND RENDERING USING JAVASCRIPT CANVAS API.....47 COMPUTER PROGRAMMING (SCRIPTING AND CODING).....50 PROCESSING AND TRANSMISSION OF ENVIRONMENTAL DATA.....53 COMPUTER SCIENCE.....55 PROCESSING AND TRANSMISSION OF ENVIRONMENTAL DATA.....58 BALANCING A VIDEO GAME.....61 GEOGRAPHIC INFORMATION SCIENCES.....64 USING GEO-SPATIAL TECHNOLOGY TO IDENTIFY URBAN HEAT.....65 THE CONNECTION BETWEEN CITY LAYOUT AND URBAN HEAT ISLANDS.....68 URBAN HEAT ISLANDS.....71 URBAN HEAT ISLAND PHENOMENA.....74 URBAN HEAT ISLAND IN THE USA.....78 PARTICIPATING HIGH SCHOOLS.....82 ===== PAGE 6 ===== Agriculture and Food Sciences ===== PAGE 7 ===== # Grafting Success on American Pawpaw (Asimina-triloba) Using Chip Bud and Whip and Tongue Grafts Joshua Dill, Junior, Ludlow Independent High School, Kentucky Dr. Kirk Pomper, Associate Director of Research, CAFSSS Jeremy Lowe, Co-Investigator, CAFSSS
Image
## Abstract This project was designed for demonstrating the process where fruit plants are produced so as to make all pieces of the same variety taste the same. I grafted pawpaw trees to see which graft, whip and tongue, or chip budding would be more successful in propagating the fruit. Both methods were performed under the same and no control plants were used. It was hypothesized that chip budding method would be more successful at fruit propagation. The preliminary results indicate that chip budding was much more successful than the whip and tongue method. This project taught me several things about grafting processes and how they are performed. The heat was killing me while I was working on the KSU Demonstration and Research Farm, but the results of the experiment made it all worthwhile. It was a great experience that taught me that you need a lot of time to complete research and a lot of hard work to go with it. ## Introduction What if one day you went into a grocery store to pick up some fruit, and one was really good and the other wasn't so sweet tasting? Have you ever had that experience, or are they all pretty good? Well, with grafting you can take the buds or new grown parts of the good tasting fruit and graft them, essentially, cloning them. This is how good fruit from the grocery store is made. Out on KSU's research and demonstration farm I took part in a research project working ===== PAGE 8 ===== with the fruit pawpaw. Pawpaw is a tree native to Kentucky and KSU has a very large pawpaw research program (Pomper et al., 2009; Pomper et al., 2010). In talks with research director Dr. Kirk Pomper I asked, “Why did you decide to go with Pawpaw instead of any other fruit?” His response, “It’s a fascinating fruit that is very tasteful and something that is new to chefs who are always looking for something new or different.” Pawpaws are traditionally grafted using chip budding, but whip and tongue is another possible method (Pomper et al., 2009; Stoltz and Strang, 2005). For this experiment, my hypothesis was that if we use chip budding to graft the desired fruit, then it would have a better outcome than whip and tongue. ## Methods & Materials I used two types of grafting in this research: the chip budding and whip and tongue methods. Chip budding involves using one little bud from the plant you want to clone and the other method involves using a stick of one-year old wood of the same variety. My early advice and experiences quickly demonstrated that chip budding is the least complicated method. Some of the materials used included a sharp knife, pawpaw plants, para film, pawpaw rootstock and pawpaw scionwood. Para film is a stretchy plastic that holds the graft together and helps hold in moisture. To complete the chip budding method we cut the bud out and made it the same size as a cut into another pawpaw tree, secured the bud to the cut tree, wrapped it with para film, and cut off only a few of leaves from the top to allow for continued photosynthesis. To complete the whip and tongue method, we took a whole stick from last year's growth and put it on another pawpaw tree, similar to chip budding, but also cutting the other tree in half. Then we made a "Z" cut into the stick while making sure it was attached to the roots. We then wrapped it in para film and put both the chip budding and whip and tongue grafts into the greenhouse and waited. In total, eight grafts for each method were completed. ## Results & Discussions After six days, I came back to check the progress. The chip budding method was doing extremely well as four of the samples propagated while the whip and tongue method produced only one. The next day, I came back to look at the results and it looked like all of the chip buddings had taken, while with whip and tongue had only produced a total of two. These results indicate that chip budding was the overall best method for grafting the pawpaw fruit trees and have proven that my hypothesis, that chip budding will give a higher number of successful grafts, was correct. ===== PAGE 9 ===== ## Future Plans With this study it could be used for testing many more ways of grafting or using a different fruit. Also being tested under different conditions to see if one method will do better than the other. Another way you could test is to give more time to the plants to see if whip and tongue will take if they're given longer time. There can be a mixture of things that can make them make them grow faster or even grow taller. ## References Pomper, K.W., S.B. Crabtree, and J.D. Lowe. 2009. Enhancing Pawpaw Chip Budding Success. Journal of the American Pomological Society, 63(4): 145-149. Pomper, K.W., S.B. Crabtree, and J.D. Lowe. 2010. Organic Production of Pawpaw. Kentucky State University Cooperative Extension Program, PBI-004. Stoltz, L.P. and J. Strang. 2005 Reproducing Fruit Trees by Graftage: Budding and Grafting. UK cooperative extension service, HO-39. ## Acknowledgments I first would like to thank Dr. Buddhi Gyawali for making this program come alive. I have learned about jobs that I never even knew existed. Without this program I would probably still be focused on something that was ridiculous for me to actually be able to reach. If you’re not proud of anything be proud that you changed this young fellows’ eyes into seeing that there are jobs out there and that I can achieve. Also I would like to thank Dr. Pomper for being a very helpful mentor along with Sheri Crabtree and most of all Jeremy Lowe you guys have taught me a lot about grafting Pawpaw and the understanding of it. Without you this project couldn’t have been possible and for that I’m forever thankful. You guys have inspired me to achieve my best. I know that any student that comes in to work with all of you will be in great hands. I would also like to thank Rebecca and Bryan for all of the help with the project. ===== PAGE 10 ===== # Can ornamental plants be propagated in 10 days? Joshua Maddox, Junior, Seneca High School, Kentucky Dr. Hideka Kobayashi, Assistant Professor, CAFSSS
Image
## Abstract Propagating ornamental plants can be a long process generally taking a month or more to complete and involves processes using sexual and asexual methods. Cutting method was examined for four different types of orchids, and two types of medium substrate for propagation of coleus (Plectranthus scutellarioides) and spider plant (Chlorophytum comosum) were examined. Preliminary results indicate that the cuttings and plantlet propagation with the vermiculite substrate performed best within the ten-day research period. ## Introduction Orchids are a universally widespread group of plants commonly used as decorative ornamentals. This orchid family is one of the largest families of flowering plants and included Vanilla (Vanilla planifolia Jacks. ex Andrews). Horticulturists have produced more than 100,000 hybrid varieties and even more numerous cultivars of orchids. Orchids can be propagated both sexually and asexually, but it is an often difficult and slow process. Sexual reproduction involves an exchange of genetic materials and, in general, none of the offspring are genetically identical. In contrast, asexual reproduction involves the acquisition of plants that are genetically identical to the mother plant via ===== PAGE 11 ===== cloning process (no gene exchange). Examples of asexual reproduction methods include the use of cuttings, plantlets (keiki), grafting, layering, and tissue culture, among others. ## Materials and Methods In this experiment, four types of orchids, coleus [Plectranthus scutellarioides L. R.Br.] and spider plant [Plectranthus scutellarioides (Thunb.) Jacques] were used. Orchid used in this experiment include three types of Epidendrum (Epi. secundum, Epi. Burtonii and Epi. Orange Passion) and one species of Vanilla (Vanilla chamissonis Klotzsch). Cuttings of these orchids were made, using sphagnum moss as a medium substrate. Orchid cuttings and sphagnum moss was wrapped with a piece of clear plastic film and kept in clear plastic tubs. One third of Epidendrum cuttings were treated with rooting powder, containing rooting hormone, to investigate its effect on orchid rooting. Similarly, cuttings of coleus were made and they were inserted into a plastic tub filled with moist vermiculite or perlite. Plantlets of spider plants were removed from the mother plant and placed on the surface of moist vermiculite or perlite in a plastic tub. After placing cuttings or plantlets, tubs were covered with a piece of clear plastic film. ## Results and Discussion In all cases, the orchids responded to the treatment within the ten-day research period while not propagated. As for the houseplants, both species types utilized were successfully propagated, but not all of the propagules survived. Overall, the cuttings and plantlets performed better with vermiculite substrate and had the higher success rates (Figure 1). ## Future Plans For the future, I plan to enroll at Kentucky State University to finish my study on orchid plant propagation and to explore why different substrates perform better when utilized with particular types of propagation methods. Also, more work is needed to understand why the success rate varies across the different plant species type, why progress is inconsistent and which mix of factors leads to the highest propagation rates. ===== PAGE 12 =====
PerliteVermiculite
Coleus100%87.5%
Spider plant66.7%93.3%
aThe number of replications are: Coleus (8) and spider plant(15).
ImageImage
Figure 1. Propagation of Coleus and spider plant with perlite and vermiculite.
## References Interviews with Dr. Hideka Kobayashi, June 2015 Wikipedia. Plant Propagation. https://en.wikipedia.org. Last accessed on 6/20/2015 Santa Barbara Orchid Estate Home Page. http://www.sborchid.com. Last accessed on 6-20-2015 ## Acknowledgments First of all, I would like thank my parents for encouraging me to reach my potential such as participating in this program. Without their help, love, and support I probably would have not met some of the friendliest people at this camp. Next I would like to thank Dr. Kobayashi for his time and effort in mentoring. I would also like to show my appreciation to Dr. Buddhi Gyawali and Dr. Teferi Tsegaye for developing the SAP program and for the enriching experience of getting closer to agriculture. ===== PAGE 13 ===== Determination of Capsaicin in Hot Peppers Jayla Motley, Junior, Christian County High School, Kentucky Ms. Regina Hall, Research Assistant, CAFSSS Mr. Eric Turley, Co-Investigator, CAFSSS
Image
## Abstract At the present time, 90% of U.S. chili pepper production occurs in New Mexico, eastern Arizona, and western Texas. Pungent hot pepper varieties are grown for their food value, health-promoting properties and also as a source of capsaicinoids (which have a variety of medicinal uses). The objectives of the investigation were: 1) to quantify the major capsaicinoids (capsaicin and dihydrocapsaicin) in hot pepper fruits accessions and 2) to identify accessions containing greatest concentrations of capsaicinoids. Hot pepper seeds were grown under four soil management practices (sewage sludge, chicken manure, yard waste, and no-mulch (control) treatment) to monitor and quantify capsaicin and dihydrocapsaicin content in pepper fruits. Ninety Capsicum accessions selected from the USDA Capsicum germplasm collection were screened for their capsaicinoids content using gas chromatography (GC/NPD). Fresh fruits of Capsicum chinense, C. frutescens, C. baccatum, C. annuum, and C. pubescens were extracted with methanol, and analyzed for capsaicin, dihydrocapsaicin and nordihydrocapsaicin content. Mass spectrometry of the fruit crude extracts indicated that the molecular ions at m/z 305, 307, and 293 which correspond to capsaicin, dihydrocapsaicin, and nordihydrocapsaicin, respectively, have a common benzyl cation fragment at m/z 137 that can be used for monitoring capsaicinoids in hot pepper fruit extracts. Quantification of capsaicinoids in the selected accessions allowed us to identify genotypes with high levels of total capsaicinoids and enabled the prediction of the amount of each component that can be obtained per kg and per acre of hot peppers produced. ===== PAGE 14 ===== The genus Capsicum is a member of the Solanaceae or nightshade family. It contains five commonly cultivated species (C. annuum L., C. frutescens L., C. chinense, C. baccatum L. and C. pubescens). Varieties of these, and other Capsicum spp., exhibit varying degrees of pungency that reflect relative concentrations of capsaicin, dihydrocapsaicin, nordihydrocapsaicin. Environmentally friendly pest-control agents for use on vegetable crops are needed to replace pesticides that are ineffective, that have been withdrawn for regulatory reasons or whose costs are prohibitive. The need for new control agents is also a result of the increasing difficulty of managing pesticide resistance. Botanical pesticides offer potential as substitutes for or supplements to be used with, synthetic pesticides. The USDA Capsicum germplasm collection contains many thousands of accessions of Capsicum spp., although only limited information is currently available on the capsaicinoid content of the fruit of these accessions. The objectives of the present investigation were 1) to quantify the major capsaicinoids in fruits of Capsicum chinense, C. frutescens, C. baccatum, C. annuum and C. pubescens accessions obtained from the USDA Capsicum germplasm collection, and 2) to screen and select candidate accessions from among those for mass production of capsaicinoids for future use as alternative insecticides. Materials and Methods Fruits from accessions of Capsicum chinense, accessions of C. frutescens, accessions of C. baccatum, accessions of C. annuum, and one accession of C. pubescens were harvested at random from field-grown plants for capsaicinoids analysis. Total capsaicinoids were extracted by blending ten fresh fruit of comparable size in methanol for one minute. The solvent extracts were concentrated to 10 mL of methanol. Each extract was subsequently passed through a 0.45 μm GD/X disposable syringe filter. One μL of this filtrate was injected into a gas chromatograph (GC) equipped with a nitrogen-phosphorus detector. GC separations were accomplished using a 25 m × 0.20 mm ID capillary column with 0.33 μm film thickness (HP-1). Quantifications were based on average peak areas of 1 μL injections obtained from external standard solutions of capsaicinoids prepared in methanol. Under these conditions, retention times (R_t) were ## Introduction ===== PAGE 15 ===== 9.06, 11.50, 11.75 min, for nordihydrocapsaicin, capsaicin, and dihydrocapsaicin, respectively. A HP gas chromatograph (GC) model 5890A equipped with a mass chromatograph operated in total ion monitoring (GC/MS) with electron impact ionization (EI) mode and 70 eV electron energy, was also used for identification and confirmation of individual peaks. Purified standards of capsaicin and dihydrocapsaicin were used to prepare calibration curves. Linearity over the range of concentrations was determined using regression analysis. Concentrations of the two dominant capsaicinoids, capsaicin and dihydrocapsaicin, as well as total capsaicinoids (capsaicin plus dihydrocapsaicin) in Capsicum species were statistically analyzed using ANOVA procedure. Means were compared using Duncan's LSD test. ## Conclusions Capsaicin is approved by the FDA for human use and is currently registered for use as a repellent against birds, deer, rabbits, and squirrels. Quantification of capsaicinoids in the selected accessions allowed us to identify genotypes with high levels of total capsaicinoids and enabled the prediction of the amount of each component that can be obtained per kg and per acre of hot peppers produced. Accessions were identified as potential candidates for the mass production of capsaicinoids, or for the breeding of varieties enhanced for capsaicin content. Future research objectives will include the development of novel formulations of capsaicinoids derived from the accessions characterized in this study, the monitoring of the effectiveness of the insecticidal activity of capsaicinoids, and persistence of capsaicinoids under field conditions. ## Acknowledgments I would like to thank my fieldwork mentors: Dr. Antonious, Mr. Eric Turley, and Ms. Regina Hill for their hot pepper information and knowledge. I would like to thank the SAP personnel for their assistance and knowledge. I would like to thank Kentucky State University for the opportunity to participate in the SAP Program. ===== PAGE 16 ===== Mealworms with a Purpose Ian J. Roberts, Junior, Trinity High School, Kentucky Ms. Regina Hall, Research Assistant, CAFSSS Mr. Eric Turley, Co-Investigator, CAFSSS
Image
## Abstract The purpose of this research was to determine if a natural pesticide could be beneficial in the near future that would have no ill effect on the receiving plants nor the people who ultimately consume the product. In addition, we looked at and discussed ways to use the targeted pest as a source of food for animals and humans and as bait for fish. ## Introduction Tenebrio Molitor is a cosmopolitan pest and is currently the most frequent inhabitant of liter and manure in turkey and broiler, and egg houses (Gould and Moses 1951, Pfeiffer and Axtell 1980, Salin 1999, Salin et. al 2003). Over the course of two weeks, I was fortunate enough to work with Ms. Regina Hill and her team in observing how to grow mealworms and how to take an in-depth look at a natural pesticide that would deter the pest from important crops. During this research we illustrated how to grow the pest to first get a better understanding of its life cycle. Depending on the food and temperature it receives, the resulting life cycle stages may vary. In addition we observed the various benefits of the pest when raised in ideal environmental conditions. A good example would be proper amounts and quality of foodstuffs. ===== PAGE 17 ===== ## Methods 1. Gather the supplies 2. Pour a one inch layer of oats into the bottom of each plastic container 3. Separate the pupa as soon as you start to notice them 4. Continue to check both containers regularly for advances in the life cycle 5. Remove adult beetles from the pupa container immediately 6. Check the adult beetle container regularly for eggs 7. Move the mealworms out of the adult beetle habitat and into the mealworm container upon hatching 8. Continue daily or weekly maintenance of the habitats ## Materials - Dry oatmeal or other grain An organic source of moisture that is not likely to mold quickly. Carrots work best for this, but you can also use other fruits and vegetables such as sliced or chopped potatoes or apples. • Plastic containers with air-holes drilled in the tops • Mealworms ## Results and Discussion Results indicate that there are 4 life cycle stages: egg, larva, pupa, and adult. When cultivating these insects, it is key to separate them as they reach each different phase, which helps with the breeding process. After a female meal is breed, she lays up to 500 eggs that hatch in 4 to 19 days (Wikipedia). Depending on the food and environmental conditions, it may take up to 100 days for them to complete their life cycle. Results indicate that the stages of larva and adult have the greatest density of protein and are most valuable as a food source at these stages. As larva, the insects look like worms and have a very high protein value that can serve as a source of food for human and fish. Also, adult insects are very efficient at propagating new offspring and continuing the local colony and the source of protein. Key notes of the research: • Keep mealworms at room temperature - Use 1-3 inches of oat bran as bedding/substrate. They will borrow in this DO NOT USE CEREAL (will mold) ===== PAGE 18 ===== - Remove pupae immediately from mealworm enclosure and put in beetle or separate enclosure. Pupae will emerge in about a week into an adult beetle. Once the beetles are transferred to the eggs in the beetle substrate will develop into the next generation of mealworm. • Mealworms need moisture. BUT NOT water or watery fruits/vegetables. This will mold the substrate. Provide potatoes, carrots, and lettuce. The mealworm should have a water source offered every few days. Beetles need a constant supply of water. Give the beetles a carrot or lettuce every other day. - Remove uneaten food periodically. Bread cereal and dog food can be added for additional nutrients, but in moderation. Offer dog food (tiny bits) for additional proteins. (This is entirely up to you) • Separation is key! ## References Gould, G. E., and H. E. Moses. 1951. Lesser mealworm infestation in a brooder house. J. Econ. Entomol. 44: 265. Pfeiffer, D. G., and R. C. Axtell. 1980. Coleoptera of poultry manure in caged-layer in North Carolina. Environ. Entomol. 42: 575D577. "Mealworm." Wikipedia. Wikimedia Foundation, n.d. Web. 26 June 2015. Salin, C. 1999. Contribution à lOe' cologie dOAlphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae), insect February 2003 SALIN ET AL.: PYRETHROID AND IGR CONTROL OF THE LESSER MEALWORM 129 associe' aux e' levages hors-sol en Bretagne. The' se Universite', Universite' de Rennes 1, France. Salin, C., Y. R. Delettre, and P. Vernon. "Controlling the mealworm Alphitobius diaperinus (Coleoptera: Tenebrionidae) in broiler and turkey houses: field trials with a combined insecticide treatment: insect growth regulator and pyrethroid." Journal of Economic Entomology 96.1 (2003): 126-130. ## Acknowledgements I would like to thank Ms. Regina Hill and her team for taking the time out of their job to serve as mentors to my team. These nice people helped us a lot. Without them we would not have any advanced understanding of the mealworm life cycle. I would also like to thank the leaders of SAP for allowing me with this opportunity and possibly finding a path I would like to follow for a career in the future. I would also like to thank them for making me feel like I'm in a safe environment and could speak up whenever I had a problem or issue. Special thanks to these people: Eric Turley, Dr. George Antonious, Dr. Buddhi Gyawali, and especially Regina Hill. ===== PAGE 19 ===== # Lady Beetles in Native Perennial Plantings Within Central Kentucky McKenzie A. Roll, Phoenix School of Discovery, Kentucky Dr. John D. Sedlacek, Interim Chair, Division of Agriculture and Natural Resources Karen Friley, Co-Investigator, Entomology, CAFSSS
Image
## Abstract Native perennial border plantings were used to do quantify lady beetle populations and diversity vs. those found in pasture border rows. Sixteen species of native perennials (11 species of flowering plants and 5 species of grasses) commonly found in Kentucky prior to European settlement and extensive agricultural production were used. Samples were analyzed from June 10 and June 16 2015. Six species of lady beetles were found in this study. Spotless lady beetle, Cycloneda munda; orange spotted lady beetle, Brachiacantha ursina; 7-spotted lady beetle, Cocinnella spetempuntata; Pink Lady beetles, Coleomegilla maculata; parenthesis lady beetle, Hippodamia parenthesis, and multicolored Asian lady beetle, Harmonia axyridis were caught. The spotless lady beetle was the most abundant species caught. Overall, there were more lady beetle species in the pasture border rows for these first 2 collections of 2015. ## Introduction Some researchers have suggested that non-crop vegetation present in crop field margins can attract populations of predaceous arthropods and parasitoids, as well as increase the diversity of all arthropods. Lady beetles are known as important predators in agricultural systems. In general, lady beetles have been reported to be attracted to annual flowering plants including sunflower (Heliathus annuus) and buckwheat (Fagopyrum carinata). ===== PAGE 20 ===== esculentum). However, additional information concerning lady beetles and other beneficial insects is needed in conjunction with border rows providing floral resources so that effective and sustainable pest control options can be identified and potentially used. Development of conservation biological control tactics such as habitat management may be expected to boost small farm income and benefit small farm communities. Thus, the objective of this research was to determine the effect habitat management/border row planting has on lady beetle diversity and abundance in native perennial and pasture border types. ## Materials and Methods This study was conducted at the Kentucky State University Research and Demonstration farm in Frankfort, KY. Native perennial and pasture border rows were established in 2012 and were used to examine lady beetle populations. Border rows were 25 meters long by 2 meters wide. Native perennial border rows were planted using 11 species of flowering plants and 5 species of grasses. The flowering species were, (Anemone virginiana) Thimbleweed, (Aster novae-anglica) New England Aster, (Echinacea purpurea) Purple Coneflowerwhile, (Erygium yuccifolium) Rattlesnake Master, (Eupatorium perfoliatum) Common Boneset, (Lobelia siphilitica) Blue Lobelia, (Monarda fistulosa) Bee Balm, (Penstemon digitalis) Foxglove Beardtongue, (Penstemon hirsutus) Hairy Beardtongue, (Pycantheum tennuifolium) Slender Mountain Mint, (Ratibida pinnata) Gray-Headed Coneflower, while the grasses were, (Schizacharium scoparium) Little bluestem, (Sporobolus heterolepis) Prairie Dropseed, (Andropogon gerardii) Big Bluestem, (Bouteloua curtipendula) Side-oats Grama, and (Panicum virgatum) Switchgrass. Insects were sampled on date and date using 15 centimeter by 15 centimeter yellow sticky traps stapled to 1.5 meter long tobacco sticks at vegetation canopy height. Four traps were placed in each row equally spaced from each other and the ends of the borders. Traps were collected weekly and placed in 1 gallon Ziploc bags, and Insects were identified using a dissecting stereoscope. The average number of lady beetle species were calculated per trap and border type and graphed using Excel. Graphs are presented as the average number of lady beetles per species. ===== PAGE 21 ===== ## Results and Discussion Six species of lady beetles were caught in this study. Spotless lady beetle, Cycloneda munda; orange spotted lady beetle, Brachiacantha ursina; 7- spotted lady beetle, Cocinnella spetempuntata; Pink Lady beetles, Coleomegilla maculata; parenthesis lady beetle, Hippodamia parenthesis, and multicolored Asian lady beetle, Harmonia axyridis were caught. The spotless lady beetle was the most abundant species caught.
Image
Figure 1. Average number of Lady Beetles per species on 10 June 2015.
Overall, there were more lady beetle species in the pasture border rows for these first two collections of 2015. Numbers of spotless lady beetles were higher in the pasture borders on the first collection date than the second date. However, by the second collection, more spotless lady beetles were found in the native perennial border rows. Pink lady beetles and 7 spotted lady beetles increased in the native perennial border rows by the second collection. This sampling is early in the growing season. As more native perennial plants flower, we expect to see more lady beetles in the native perennial border rows. Based on the limited data we have thus far, floral resources appear to positively impact some of the Lady beetle species and not others. Trapping needs to continue to determine seasonal trends in these habitats. In addition, we need to identify and enumerate other beneficial insects, such as big-eyed bugs, minute pirate bugs and syrphid flies to determine their abundance and activity. ===== PAGE 22 =====
Image
Figure 2. Average number of Lady Beetles per species on 16 June 2015.
Table 1. Lady Beetle Species Found in Collections
Spotless lady beetleCycloneda munda
Orange spotted lady beetleBrachiacantha ursina
7-spotted lady beetleCoccinella septempuctata
Pink lady beetleColeomegilla maculata
Parenthesis lady beetleHippodamia parenthesis
Multi-colored Asian lady beetleHarmonia axyridis
## References Fiedler, A., J. Tuell, R. Isaacs and D. Landis. 2007. Attracting beneficial insects with native flowering plants. Michigan State University. Extension Bulletin, E-2973. http://nativeplants.msu.edu/pdf/E2973.pdf Marshal, S.A. and D.K.B. Cheung. Common Lady Beetles of Ontario. University of Guelph. www.uoguelph.ca/debu/posters/coccinellidae.jpg ## Acknowledgments Great thanks to Kentucky State University, including, Dr. John Sedlacek, Ms. Karen Friley, Ms. Denita Brown, Mr. Kyle Slusher, Dr. Buddhi Gyawali, Mr. Andrew Gott, and Mr. Jeremy Sandifer. ===== PAGE 23 ===== Aquaculture Sciences ===== PAGE 24 ===== # Fish Disease Ottis Jaggers, Sophomore, Phoenix School of Discovery, Kentucky Dr. Robert Durborow, Professor & State Extension Specialist for Aquaculture Research
Image
# NE SARCASTIC COMMENT IN ## Abstract For the last two weeks I have been apprenticing under a fish disease specialist named Dr. Durborow. With Dr. Durborow I have learned many things including, how to diagnose fish diseases and issues, how to test bacteria, and how to check for parasites. I participated in a great deal of experiments that included testing dead fish for diseases, water quality tests, and mass dissections to take tissue samples. The last two weeks have been very insightful and have helped me grow as not only a person, but as an aspiring student. ## Introduction The first dissection that I participated in was from not far away from the Kentucky State University (KSU) campus. Mysteriously, many fish had gained abscesses on their skin, which at first glance, resembled that of a parasite. Shortly into the exploratory dissection, we found that they did not have parasites, but rather, some form of disease. It was decided to take samples to investigate further; one from the brain, one from the infected spot, and some from many other body parts. The samples, and the collected bacteria, were allowed to sit and propagate into colonies. For the first twenty-four hours, it did not seem to have any bacteria, but after forty-eight hours it began to form large colonies. Multiple types of colonies were present: a small white colony, a small tan colony, and large mucus like colony of which seemed the most likely to be the ===== PAGE 25 ===== culprit. This finding was used to generate a testable hypothesis: that the mucus-like colony was the one causing the abscesses on the host fish. The experiment performed helped us to realize that all of the bacteria are weak against one drug, and that if we introduce this into the water it should kill all three, or at the very least stop the bacteria from spreading to other fish. ## Methods and Materials During the experiment I utilized a series water quality tests by taking samples from the water and testing them to see if is of appropriate quality for fish to live in. Water tests were also used to detect the presence of any known parasitic organisms calling the water home. We also tested the water for acidity, alkalinity and pH balance. The water that was tested appeared to be fairly decent in all of the tests and seemed to be fitting for fish to live in. No known parasites were detected in the water tests. On June 22, I participated in what can be called a mass dissection, which was done to test the health of fish in a community pond. We began by driving to an aquaculture farm on Bardstown road in Louisville Kentucky. We had obtained 150 fish samples in total and had been instructed to cut each one open, take liver and kidney samples, and put 5 samples of each organ into each vial. Analysis of the samples indicates that the fish were phenomenally healthy and seemed to be nearly perfect with the exception of one thing, parasites. The two types of parasites identified were the Yellow Grub and the Bass Tape worm. In spite of the parasite infections, the fish and the aquatic habitat were deemed to be reasonably healthy. ## Results and Discussion For these two weeks I have learned many things that helped change my look on KSU's role in the field of aquaculture. Some such things are checking fish for diseases, performing water quality tests, and identifying parasites. The experiments that we performed allowed me to push further into the medical sciences, and aided in my goal of gaining hands-on experience. I thoroughly enjoyed my time here at KSU and in the SAP program, and I am glad to have gained the experiences overall. ===== PAGE 26 ===== # Acute Toxicity of Total Ammonia-Nitrogen to Larvae of the African River Prawn Lucny Jean, Sophomore, Lake Wales High School, Florida Shawn Coyle, Co-Investigator, Aquaculture r. James H. Tidwell, Professor and Division Chair, Division of Aquaculture
Image
## Abstract The African River prawn (Macrobrachium vollenhovenii) is native to western African countries including Senegal and Cameroon and has potential as an aquaculture species due to its large size. The effect of ammonia on larvae was evaluated to provide basic information on safe levels for larviculture. A 96 h static assay was performed on 1-day-old M. vollenhovenii larvae. The nominal concentrations tested ranged from 2 to 16 mg NH4/L. Water temperature was maintained at 26circC by use of a single water bath and a submersible heater. The salinity of the test water was 16 ppt. The 96 h LC50 value was calculated to be 7.4 mg/L and the ‘safe level’ was estimated to be 0.74 mg/L. These results suggest that M. vollenhovenii exhibits a lower tolerance to ammonia when compared to other species of freshwater prawn. ## Introduction The African River prawn (Macrobrachium vollenhovenii) is native to western African countries, including Senegal and Cameroon, and has potential as an aquaculture species due to its large size. In Africa, it is a commercially important species especially in the country of Cameroon where an active fishery exists. Ammonia is the main excretory product in crustaceans (Cavelli et al. 2000). This is an end product of amino acid catabolism originated from excretion and organic matter ===== PAGE 27 ===== decomposition. High ammonia concentrations in larviculture tanks can result in mortality and poor performance even at sub lethal levels. Different species are known to vary greatly in their tolerance to ammonia. Therefore, knowledge of the ammonia tolerance levels of candidate species is important for the culturist in order to optimize survival. The effect of ammonia on larvae was evaluated to provide basic information on safe levels for larviculture of M. vollenhovenii. ## Materials and Methods A 96 h static assay was performed on 1 day old M. vollenhovenii larvae. The nominal concentrations tested ranged from 2 to 16 mg NH4/L (0, 2, 4, 8 and 16 mg/L) with three replicate beakers per treatment dose. Water temperature was maintained at 26circC by use of a single water bath and a submersible heater. The salinity of the test water was adjusted to 16 ppt using a commercially available marine mix (Crystal Sea™, Baltimore, MD). Ten one-day-old prawn larvae were individually counted into each of eighteen 200 ml glass beakers containing 200 ml of preconditioned water. Test concentrations of ammonia were obtained by first making a test solution of reagent grade ammonium chloride (NH4Cl) and then applying by pipette from the solution to the individual beakers. Mortalities were observed under a magnifying glass and recorded every 24 hours. Ammonia concentrations were measured using a spectrophotometer to test accuracy of serial dilutions. Data were analyzed using Probit Analysis EPA edition. ## Results and Discussions There was no mortality in control treatments during the experiment. Neither was observed any mortality during the first 24 hours of exposure for all ammonia concentrations. After 96 h, all larvae exposed to the highest concentration tested (16 mg/L) died. The 96 h LC50 value was calculated to be 7.4 mg/L (Figure 1). These results suggest that M. vollenhovenii exhibits a lower tolerance to ammonia when compared to other species of freshwater prawn including: Macrobrachium ===== PAGE 28 ===== rosenbergii (96 h LC50 =14 mg/L) and Macrobrahium tenellum (72 h LC50 = 12.6 mg/L) (Armstrong 1978; Figueroa-Lucero 2012). Sprague (1971) suggested that “safe levels” of a given toxicant could be determined by an application factor of 0.1 to LC50 values. According to our results, safe level would be below 0.7 mg/L TAN or 0.07 mg/L NH3. These data will benefit culturist working on larviculture development of M. vollenhovenii.
Image
Figure 1. Total concentrations are shown along with survival rates.
## References Armstrong, D.A., D. Chippendale, A. Knight and J. Colt. 1978. Interaction of ionized and un-ionized ammonia on short-term survival and growth of prawn larvae, Macrobrachium rosenbergii. Biio. Bull., 154:15-31. Cavalli R.O., Vanden B.E. Lavens P., Thuy N.T.T., Wille M. and Sorgeloos P. (2000). Ammonia Toxicity as criterion for the evaluation of larval quality in the prawn Macrobrachium rosenbergii. Comp. Biochem. Endo. 125, 333-343. Figueroa-Lucero, G., M.C. Hernandez-Rubio, M.G. Gutierrez-Ladron. 2012. Acute toxicity of ammonia on Macrobrachium tenellum (SMITH) larvae. Rev. Int. Contam. Ambie. 28 (2) 145-150. Sprague, J.B. 1971. Measurement of pollutant toxicity to fish. III. Sublethal and “safe” concentrations. Water Res. 5: 793-821. ## Acknowledgements The authors would like to thank the National Science Foundation Historically Black College and Universities-Undergraduate Program (NSF-HBCU-UP) and the United States Department of Agriculture-Capacity Building Grant (USDACBG) to promote minority students' participation in STEAM-undergraduate degree programs. ===== PAGE 29 ===== # Optimizing the Use of Algal Meal (Schizochytrium sp.) as a Fish Oil Replacer in Pacific White Shrimp (Litopenaeus vannamei) Rebecca Wang, Paul Laurence High School, Kentucky Naima Martin, Presentation Academy, Kentucky Dr. Vikas Kumar, Assistant Professor, Aquaculture Nutrition Mr. Ken Thompson, Co-Investigator, Aquaculture
Image
Image
## Abstract Microalgae (Schizochytrium sp.) may be a sustainable alternative to fish oil for Pacific white shrimp, Litopenaeus vannamei. This project provides useful information on alternative nutritional technologies to replace expensive fish oil by algae meal rich in oil. Juvenile shrimp were counted and weighed after one month of growth in an indoor recirculating aquaculture system. After thirty days, growth performance and feed utilization of juvenile shrimp fed algae oil and fish oil were similar demonstrating that algae oil has a potential for use in aquaculture diets. Data suggests that algae meal can be used as promising fish oil replacer in the diets of marine shrimp if formulated similar to the present study. The results of this study enlarge the portfolio of plant oil sources that can be used in shrimp diets and open a new market opportunity for use of a new feed resource in the aqua feed industry. ## Introduction According to the Food and Agriculture Organization (FAO) almost half of the world's fish supply for human consumption derives from aquaculture production (FAO, 2012). The world's production of captured and farm-raised shrimp is more than 6 million ===== PAGE 30 ===== tons, of that shrimp farming is booming beyond 2.5 million tons (FAO, 2012). Because of their fast growth, high market value, and resistance to disease the Pacific white shrimp (Litopenaeus vannamei) is particularly suitable for intensive cultivation (Williams et al., 1996; Liu et al., 2012). Currently, the Pacific white shrimp is the most single valuable aquaculture commodity (FAO, 2012). In fact, the production of this shrimp generated US $11 billion in 2010. However, over 90 percent of these farmed-raised shrimp rely on high protein diets and typically contains high percentages of fish meal and fish oil. As a result, this has created a large concern, considering how fish oil is expensive. Likewise, shrimp diet costs can account for between 50-80 percent of a producer's operational costs which directly influences profitability. As a way of relieving this concern, while maintaining/optimizing total growth of the shrimp, a clear-water culture system was used to culture Pacific white shrimp while fed eight (8) different experimental practical diets. Notably, diets were formulated by Dr. Vikas Kumar to evaluate the ability of algal meal as a partial or complete replacement of more expensive fish oil. ## Objectives This study was conducted to determine optimal levels of algal meal as an oil source replacement for fish oil in diets for Pacific white shrimp while evaluating overall growth performance and nutrient utilization. ## Materials and Methods The outline of the experiment is presented in Figure 1. Shrimp diets were formulated to replace fish oil with combinations of Schitzochytrium algae meal, linseed oil, and soybean oil. Other ingredients such as fish meal, soybean meal, wheat meal, wheat gluten, and vitamins and minerals were formulated to meet the known nutrient and energy requirements of shrimp (Table 1). ===== PAGE 31 =====
Image
Figure 1. Experiment outline adapted for this project.
Table 1: Experimental diets were formulated to contain different ratios of lipids (oils): fish oil (FO); Linseed oil (LO); Soybean oil (SO); and Algal oil (AO).
Lipid sourcesPractical Diets
FOAO1AO2AO3AO4AO5+LOAO5+SOAO6
Fish oil6.03.01.5----------
Linseed oil------0.51.01.0----
Soy oil--2.02.52.51.0--1.0--
Algal oil--1.02.03.04.05.05.06.0
In making the experimental shrimp diets, Diet 1 was the control and formulated similarly to a commercially available diet containing 25 percent fish meal. As diets 2-8 progress, amount of fish oil decreases until eventually none is added, while algae meal increases. Once formulas were determined by Dr. Kumar based upon ingredients' expense, appeal, digestibility, and protein/fatty acid profile and a plant and animal oil ratio of 1:1, dry ingredients were gathered and weighed; mixed for one hour using a ===== PAGE 32 ===== Hobart mixer; extruded into spaghetti-like strands; air-dried using drying racks for 24 hours; grinded up into small shrimp pellets and sieved; oils were then added and then stored in the freezer until fed. Juvenile shrimp were fed four (4) feedings per day (8:00am, 11:15am, 3:15pm, 6pm) at 15 percent of total shrimp body weight and adjusted higher or lower based upon feeding activity. Dissolved oxygen, salinity, pH, and water temperature were measured daily using a Hydrolab Quanta Water Quality Handheld Monitoring System: Model QD 02152, while total ammonia nitrogen and nitrite levels were recorded twice weekly. To account for water-loss from evaporation and routine maintenance (siphoning), approximately 5 percent of the total water volume was replaced daily. Tanks were siphoned daily to remove leftover feed and feces. Growth and feed utilization parameters were calculated as follows: ✓ Body mass gain (\%) = [(Final body mass - initial body mass)/Initial body mass] x 100 ✓ Specific growth rate (%/day) = [((ln final body mass in g) - (ln initial body mass in g))/number of trial days] x 100 ✓ Feed conversion ratio (FCR) = dry feed fed (g)/body mass gain (g) ✓ Protein efficiency ratio = body mass gain (g)/crude protein fed (g) ✓ Lipid efficiency ratio = body mass gain (g)/crude lipid fed (g) ## Results
Table 2: Data from table below demonstrates that water quality parameters were within optimal range for Pacific white shrimp.
15-Jun-1516-Jun-1517-Jun-1518-Jun-1519-Jun-1520-Jun-15
Temp (°C)29.2629.2128.928.8428.8228.79
pH6.047.467.57.857.82
DO (ppm)4.154.284.14.13.55
Salinity (ppt)25.826.327.5128.0828.1628.23
Nitrite (ppm)0.675
TAN (ppm)0.27
Initial weight, final weight, and percent survival parameters are presented in Table 3 showing positive results for those shrimp fed algal oil in combination with other ===== PAGE 33 ===== lipids without fish oil. Figures 2-5 report further growth performance parameters and nutrient utilization. Preliminary data indicates that algae meal exhibited better performance than other oil sources used in the present study. Results may change as the study will continue another eight weeks, but the first 30 days show much promise in efforts to remove fish oil completely in Pacific white shrimp diets when 25 percent fish meal is added.
Table 3: Effects of different dietary source of lipid (fish oil, FO; algal oil, AO; soy oil, SO; and linseed oil, LO) on growth and survival of pacific white shrimp.
DietsFOAO1AO2AO3AO4AO5+LOAO5+SOAO6
Initial weight (g)3.143.133.113.273.313.013.133.11
Final weight (g)9.819.9310.559.749.8510.2810.2310.37
Survival (%)10097931001001009797
Image
Figure 2: Body mass gain (%) of Pacific white shrimp fed eight experimental diets for one month.
===== PAGE 34 =====
Image
Figure 3. Specific growth rate (%) of Pacific white shrimp fed eight experimental diets for one month.
Image
Figure 4. Feed conversion ratio (FCR) and protein efficiency ratio (PER) of Pacific white shrimp fed eight experimental diets for one month.
===== PAGE 35 =====
Image
Figure 5. Lipid efficiency ratio of Pacific white shrimp fed eight experimental diets for one month.
## Outcomes Preliminary results after 30 days of the present feeding trial indicates that microalgae Schitzochyrium have the potential to develop into a sustainable alternative to fish oil for use in aquafeed. This research may provide valuable information on alternative nutritional technologies to replace fish oil for Pacific white shrimp that currently represents a significant part of total feed cost for shrimp producers. ## References FAO, 2012. State of world fisheries and aquaculture 2012. Food and Agriculture Organization of the United Nations. Fisheries and Aquaculture Department, Rome, Italy. Liu, Xiang-he., Ye, Ji-dan., Wang, K., Kong, J., Yang, W., Zhou, L., 2012. Partial replacement of fish meal with peanut meal in practical diets for the Pacific white shrimp, Litopenaeus vannamei. Aquac. Res. 43, 745–755. Williams, A.S., Davis, D.A., Arnold, C.R., 1996. Density-dependent growth and survival of Penaeus setiferus and Penaeus vannamei in a semi-closed recirculating system. Journal of the World Aquaculture Society 27, 107-112. ## Acknowledgements We would like to thank Dr. Vikas Kumar and Dr. Ken Thompson for their guidance and mentorship throughout the program. ===== PAGE 36 ===== # Interdisciplinary Behavioral and Social Sciences ===== PAGE 37 ===== # Voices I Tamara Humphrey, Junior, Spencer County High School, Kentucky Dr. Mara Merlino, Associate Professor, Psychology and Sociology
Image
## Introduction The Voices Project was a survey conducted to measure public perception of police. After seeing the results of the survey, we wanted to know if public perception of police matched individual experiences with police. Previous studies, like George Gerbner's Cultivation Theory (Gerbner, 1970), have shown that negative media portrayed in social media does in fact affect the public's perception of police in a negative way. This study was important because public perception of police affects how the criminal justice system works. In this paper, our hypotheses regarding certain factors, like an individual's demographics, relationships with police, or their exposure to the criminal justice system and their effect on perception of the police, will be discussed. ## Materials and Methods The survey for this project was created using Survey Monkey, and was deployed to the public through Facebook and Twitter. We constructed a total of 56 questions, consisting of both open-ended and multiple choice questions to determine an individual's perception of the police and their demographic information. Some of the questions participants were asked were: What is your sex? What is your political orientation (using ===== PAGE 38 ===== a bipolar Likert scale)? How many police officers do you know personally? Using the scale (semantic differential), how would you describe police officers? Semantic differential scales are used to measure perception of a group or object by using adjectives on a bipolar scale, for example, participants would rank police officers on a scale ranging from polite to impolite. The survey resulted in a total of 67 responses, which we then analyzed. Once we gathered the data from the survey, we coded the responses so that we would be able to see the relationships between factors more easily. For example, for a yes or no question, group 1 would be the participants that responded "yes" and group 2 would be the participants that responded "no". Then, we had to assess the relationship between certain factors, like sex and their perception of the police, for example, so we conducted a t-test. T-tests were also conducted to determine the relationship between exposure to the criminal justice system and perception of police and to assess the relationship between political affiliations with perception of police. ANOVA was used to assess the relationship between location and perception of police. A correlation was performed to show whether an individual's relationship with police affected their perception of police. ## Results and Discussion When we began the research, we thought about the effect location would have on perception of the police. We hypothesized that individuals living in urban areas would have a higher score (more negative feelings towards police) than suburban residents, and that suburban residents would then have a higher score than those living in rural areas. This hypothesis arose from the observation that urban areas have more crime than rural areas so the urban residents would be more likely to have more (possibly negative) interactions with the police. This hypothesis was supported by our results. We also hypothesized that the number of relationships a participant had with a police officer would correlate with their perception. We believed this would affect perception significantly because participants would likely see police officers in a more positive way (a lower score) if they had family members, for example, who were police officers. We conducted a bivariate correlation using Pearson's Product Moment to test our hypothesis. This hypothesis was also supported by our data; the number of relationships the participant had with the police negatively correlated with the average of scores, r(52) = - ===== PAGE 39 ===== .286, p = .038. Our last hypothesis, again, dealt with exposure to the criminal justice system. We hypothesized that participants of the survey who had been victims of crime would have a more positive perception of police. We formed this hypothesis because police generally help victims of crime and affect them in a positive way and our hypothesis was supported by the data.
Table 1. Views of Police by Variable
SexMSDNp
Male3.890.9713.297
Female3.491.2338
VictimMSDNp
Yes3.881.2426.047*
No3.241.0227
PoliticalMeanSDNp
Liberal3.761.0835.086
Conservative3.161.317
*. Significant at the .05 level
We also explored the relationship between sex and perception of the police. Our hypothesis was that females would score lower on the perception scale (more positive) and males would be more likely to score higher (more negative). We considered this relationship because it is likely that police would be nicer to females than males. However, this hypothesis was not supported, p = .297, ns. We also hypothesized that political affiliation would affect an individual's score on the perception aspect of the survey, but this hypothesis also had no factual support, p = .086, ns. Two other hypotheses we generated dealt with with an individual's exposure and experience with the criminal justice system. We believed that if an individual had been arrested or convicted of a crime, they would feel more negative towards the police due to the negative context surrounding their interaction. However, this hypothesis did not have any support from our data. ## Future Plans This research could be further expanded to reach a wider, more diverse audience in the future to provide a greater range of variation. More participants would mean more data to analyze that could lead to more supported hypotheses or more unsupported. ===== PAGE 40 ===== hypotheses. For example, the survey was limited in that the female participants greatly outnumbered the male participants; this affected results because we did not have an equal representation of each participant group. The study could also be used to prove or disprove more hypotheses related to public perception of police. One hypothesis that could be tested in the future is whether location by state or region affects perception of police. ## References Gerbner, G. (1970). Cultural indicators: The case of violence in television drama. The Annals of the American Academy of Political Science, 388(1), 69-81. ## Acknowledgments I would like to thank Ivan Duvall for his assistance and writing tips. I would also like to thank Ja’Lynn Joyce for being a great research partner, making this experience enjoyable, and being a very hard worker. I would like to thank Dr. Gyawali for the opportunity to experience the STEM fields here at Kentucky State University. ===== PAGE 41 ===== Voices II Ja’Lynn Joyce, Junior, Stiver School for Arts, Ohio Dr. Mara Merlino, Associate Professor, Psychology and Sociology
Image
## Introduction The Voices Project’s goal was to analyze how public perception of the police matches with individual experience with the police using a survey. Within the survey, participants were asked about their demographics, use of social media, and views about the police. Research done by George Gerbner shows that negative media exposure of the police affects the public’s view and their opinions toward police leads to a sense of mistrust. Public perception of the police is important in the success of the criminal justice system. This paper specifically discusses how older individuals tend to stand by police and have a more positive outlook on them versus younger individuals that tend to more negative perceptions of police. It is also noted that African-Americans do have a more negative view about the police than do Caucasians. That if a person tends to only view positive or negative sources, it does influence positive or negative views about police and if the number of social media sources a person uses where police are portrayed negatively would make them have negative perception of the police. The number of links a person has to outside information about the police does affect how people view them because of the many different stories and points of view. Also that the credibility of those links to outside sources does play a role on how people see the police. And how frequently people are ===== PAGE 42 ===== exposed to the news with stories about the police as part of overall media exposure does determine their opinions about the police. ## Materials and Methods To answer the research question regarding whether public perceptions of police match individual experiences with police, we came up with a list of questions under three categories: general demographics, social and news media, and feelings toward the police. We used Survey Monkey to create a variety of open ended and multiple choice questions. Participants also completed questions using the semantic differential scale to gauge their general opinions of the police. The semantic differential measures the meaning of attitude objects using a bipolar adjective structure that addresses the dimensions of evaluation strength and agency. When the survey was completed, it was then deployed to the public through Facebook, Twitter, and various web links. Some of the specific questions asked were: How often do you use social media? What social media outlets do you use? What kind of links do you click on? How credible would you consider the information provided in these links? A total of fifty-six questions were developed for the survey. Once the data was extracted from the survey, we then coded all of the answers provided from the sixty-seven participants. For instance, group one would equal yes and group two would equal no or group one would equal female and group two would equal male. After the coding was finished, we begin testing our hypotheses using SPSS statistical software. In order to analyze the relationship between race and their perception of the police, a t-test was conducted. A t-test was also conducted to distinguish the relationship between whether a person was more likely to click on negative or positive types of information and the impacts on their perception of police. A correlation was performed to assess whether the number of social media sources (media exposure) or the individuals age significantly affected how they feel about the police. Correlations were also performed to assess if how often an individual watches the news affects their view of the police, whether the credibility of the news reports or information changes their view, and if the number to outside information from web links affects their opinions about the police. ## Results and Discussion To answer our research question, we came up with a number of hypotheses regarding social media and news programs. One hypothesis that we explored was that race does determine ===== PAGE 43 ===== an individual’s feelings and thoughts towards police. Because our survey participants were mainly African-American or Caucasian, we hypothesized that African-Americans would have a more negative view about the police more than Caucasians. Race is a big issue for a lot of people when it comes to the criminal justice system. People believe that the treatment you receive from police officers does have to do with an individual’s race. Our data does support this hypothesis by an independent samples t-test.
Table 1. Views of Police by Variable
SexMSDNp
Male3.890.9713.297
Female3.491.2338
VictimMSDNp
Yes3.881.2426.047*
No3.241.0227
PoliticalMeanSDNp
Liberal3.761.0835.086
Conservative3.161.317
*. Significant at the .05 level One hypothesis in regards if the type of information like positive news stories, negative news stories or both, would affect an individual's thoughts on police. We hypothesized that if negative news stories were more likely to catch an individual's attention, they would have a more negative perception of the police because negativity is all that individual saw. However, this hypothesis was not supported by the data. We then conducted a series of bivariate correlations to investigate relationships between the participants' use of social media and news programs and the average of the scores. The hypothesis of if the number of social media sources a person uses where police are portrayed negatively, they would have a negative opinion was not supported by the data, p=.735, ns. Along these lines, we hypothesized that how credible people think these sources does affect how they feel about the police but this was not supported by the data, p=.755, ns. We also hypothesized that the number of links a person was exposed to outside information about the police does affect how people view the police because not every source has the same story or point of view but this hypothesis was not supported by the data, p=.505, ns. We hypothesized that the older an individual was they would stand by police and have a more positive outlook on them versus someone who is younger and would have a more negative view. ===== PAGE 44 ===== on the police because of the different eras the age groups were raised in but the data did not support this hypothesis, p=.706, ns. We also hypothesized that how frequently one person was exposed to the news and stories about the police due to media exposure could determine and correlate with their opinions about the police, this hypothesis was also not supported, p=.323, ns. ## Future Plans This research project could be further expanded to a much larger and diverse audience. If it had more participants, there would be a greater range of variation in responses and attitudes. Also, more participants would mean more data to analyze that could lead to more strongly supported hypotheses testing. For example, the survey was limited as far as gender. There were more women than males who participated. The survey included a question about annual income and the answers the participants gave were more on the high end. If this survey were deployed to people so that there would be a greater range in the income values, there would be a significant difference on people's perception of the police that would lead to a new hypothesis generation. The survey was also limited in time, it was only up for a week before data was analyzed. In the future, the survey could be deployed for a longer period of time to receive more results. ## References Gerbner, G. (1970). Cultural indicators: The case of violence in television drama. The Annals of the American Academy of Political Science, 388(1), 69-81. ## Acknowledgements I would like to thank Ivan Duvall for his assistance and writing tips. I would also like to thank Tamara Humphrey for being a great research partner and for making this experience worthwhile. She worked really hard by my side and without her this project would not have been as successful. I would like to thank Dr. Gyawali for the opportunity to be a part of his STEM program at Kentucky State University. Last but not least, I would like to thank the National Science Foundation Historically Black College and Universities-Undergraduate Program and the United States Department of Agriculture-Capacity Building Grant to promote minority students' participation in STEAM-undergraduate degree programs. ===== PAGE 45 ===== Molecular Biology ===== PAGE 46 ===== # Using Polymerase Chain Reaction to Identify Components of Unknown Meat Samples Caroline Wright, Junior, Paul Laurence Dunbar High School, Kentucky Dr. Li Lu, Assistant Professor of Biology, Division of Mathematics and Sciences Bruce Griffiths, Assistant Professor of Biology, Division of Mathematics and Sciences
Image
## Abstract Many batches of packaged meat have been identified as being contaminated with types of meat not indicated on the labeling. For quality and product integrity testing purposes, this study is being enacted. The objective of this study is to determine if molecular methods such as polymerase chain reaction can be used to effectively identify components of unknown ground meat samples. ## Introduction Recently, false labeling of packaged meat has come to light in the international media. With widespread cases of horsemeat mixed in with supposedly “100% beef” samples in Europe, product integrity has become a large issue (W1). Because of this, this experiment is designed to determine if the molecular method of polymerase chain reaction can be used to identify the components of an unknown ground meat sample. ===== PAGE 47 ===== ## Materials and Methods ## DNA Extraction DNA was extracted using the Wizard Genomic DNA Extraction kit (Promega, Madison, WI, USA) under the following conditions. Small samples of whole tissue derived from beef, chicken, pork, and lamb were placed in microcentrifuge tubes. Each tube was then added with 600µl nuclei lysis solution, 120µl EDTA, and 17µl proteinase K. The microcentrifuge tubes were then incubated at 65°C for 75 minutes. The tubes were shaken every 15 minutes during the incubation stage. At the completion of the incubation period, the process to break down RNA began with adding 10µl RNase to each microcentrifuge tube. The tubes were then incubated at 37°C for 15 minutes. After incubation, the tubes were vortexed after 200µl protein precipitation solution was added to each. The tubes were then chilled in the freezer for 10 minutes, after which they were put into the centrifuge and ran at 13,300 g for 5 minutes. The DNA was then isolated in the –precipitating process of placing 600 µl room temperature isopropanol in 4 new microcentrifuge tubes. 600µl supernatant present after centrifuging was then extracted from each original microcentrifuge tube and then inserted into its respective new tube. The new tubes were then chilled for 10 minutes in the freezer. After chilling, the tubes were placed in the centrifuge and ran at 13,300g for 10 minutes. This resulted in the DNA pellet being isolated in each tube. Once removed from the centrifuge, the supernatant was discarded carefully. Then 600µl 70% ethanol was added to each tube to wash the pellet. The tubes were then placed back into the centrifuge, where they were ran at 13,300g for 5 minutes. After discarding the ethanol carefully, the pellet was air-dried at 37 °C for one hour and then dissolved with 100µl double-distilled water. DNA was extracted from the unknown ground meat samples using the same procedures described above. ## PCR amplification For DNA isolated from whole meat samples, PCR amplifications were performed in a final volume of 20μl comprised of 4μl DNA template, 1.5μl forward species specific primer, 1.5μl reverse species specific primer (Table 1) (Lahiff, et al., 2001), 0.4μl 10mM dNTP, 0.5μl Taq enzyme, 4μl 5x Taq buffer, 2μl 25mM MgCl₂, and 6.1μl deionized water. PCR amplification was performed in a Veriti 96 well Thermal Cycler with the following conditions: denaturation at 95°C for 1 minute, annealing at 58°C for 1 minute, and elongation at 72°C for 1 minute. ===== PAGE 48 ===== minute for 40 cycles, concluded by a final elongation at 72circC for 7 minutes. The finished PCR were stored at 4circC or -20circC until gel electrophoresis. For DNA isolated from the unknown ground meat samples, PCR amplifications were performed on following the same procedure above with the following changes; 2μl DNA template, 0.4μl Taq enzyme, 8.2μl deionized water, annealing at 59°C or 60°C for 1 minute, PCR was done in a genetics lab using pipette tips with aerosol barrier to minimize the risk of cross contamination. ## Gel Electrophoresis Agarose gel electrophoresis was performed to analyze PCR results. 6μl 5x loading buffer was added to each PCR product, and the 26μl solutions were analyzed through gel electrophoresis on 2% agarose gel run in 0.5xTBE buffer at 80V for 1-2 hours. For the unknown meat samples, electrophoresis was done using 60V to increase resolution. The Promega 25bp DNA Step Ladder was used as size standard but the stock seemed to be degraded based on the later results.
Table 1. PCR oligonucleotide primers are shown along with target species and results.
Target SpeciesSequence of the primersExpected PCR results
Bovine5' GCCATATACTCTCCTTGGTGACA 3'5' GTAGGCTTGGGAATAGTACGA 3'271 bp
Chicken5' GGGACACCCTCCCCCTTAATGACA 3'5' GGAGGGCTGGAAGAAGGAGTG 3'266 bp
Porcine5' GCCTAAATCTCCCCTCAATGGTA 3'5' ATGAAAGAGGCAAATAGATTTTCG 3'212 bp
Ovine5' TTAAAGACTGAGAGCATGATA 3'5' ATGAAAGAGGCAAATAGATTTTCG 3'225 bp
## Results and Discussion In concern to primer testing, there was cross amplification across samples as well as non-specific results (Figure 1). This may be due to accidental cross-contamination, the primers were not specific enough, and/or the PCR parameters were not strict enough. Also, the annealing temperature of 60circC resulted in amplified and non-specific results, so in the future this temperature can be further raised. ===== PAGE 49 ===== With the electrophoresis results of the unknown ground samples, there was no chicken amplification in any of the samples, so there is a high chance that none of the samples are comprised of chicken. There was strong amplification of bovine and ovine primers, so the samples are more likely comprised of beef and lamb than the other meats.
Image
Figure 1. PCR amplification of lamb DNA with bovine, chicken, porcine, and ovine primers. Lane 1. Bovine primers, weak non-specific amplification; lane 2. Chicken primers; lane 3: porcine primers, weak non-specific amplification; lane 4. Ovine primers, strong amplification as expected.
## Future Plans In the future, the PCR parameters would need to be adjusted, such as raising the annealing temperature. Also, stricter, more specific primers would need to be designed in order to obtain the most accurate results. ## References Lahiff, S., M. Glennon, L. O»Brien, J. Lyng, T. Smith, M. Maher, and N. Shilton. "Species specific PCR for the Identification of Ovine, Porcine and Chicken Species in Meat and Bone Meal (MBM)." Molecular and Cellular Probes 15.1 (2001): 27-35. Print. W1. No Author. 2013. “Aldi confirms up to 100% horsemeat in beef products”. The Guardian News. http://www.theguardian.com/business/2013/feb/09/aldi-100-percent-horsemeat-beef-products. Accessed June 2015. ## Acknowledgments I would like to thank Dr. Li Lu for teaching and aiding me with this project and the National Science Foundation- Historically Black College and Universities-Undergraduate Program and the United States Department of Agriculture-Capacity Building Grants to promote minority students' participation in STEM-undergraduate degree programs. ===== PAGE 50 ===== Computer Sciences ===== PAGE 51 ===== # Graphics Scene Modeling and Rendering Using JavaScript Canvas API Santell Atiba, Junior, Waggenor Traditional High School, Kentucky Dr. Zhanping Liu, Assistant Professor, Division of Computer Sciences
Image
## Introduction Starting Tuesday June 16th 2015, I began to work with Assistant Professor Dr. Liu on a research project involving the generation of graphics using open source programming language. Computer programming is an important part of the economy and concerns more of the job market each year (GeekWire, 2015). At that time I knew almost nothing about creating graphics. In fact, I didn’t even know what graphics really were. So my research was not only learning about graphics, but also learning how to create graphics using JavaScript. In the six sessions, I would have with Dr. Liu I experienced lots of the processes involved in writing JavaScript language programs to create various shapes and textures, and ultimately, complete graphics. ## Development Environment In order to create graphics I was resourced with a room filled with computers, naturally, and the constant assistance of Dr. Liu that gave me the great environment for completing this work. I needed to concentrate due to the demanding and meticulous nature of computer programming. An important component of the workspace involves listening music from time to ===== PAGE 52 ===== improve creativity and longevity. The research programming was conducted using the built-in programming interface feature that utilizes JavaScript programming language. This browser software was utilized because it is easily publicly available, widely deployed, free of charge and is compatible across operating systems including both Windows and Mac. ctx.lineWidth = 20 ctx.beginPath() ctx.arc(525, 210, 40, .5 * Math.PI, 1.5 * Math.PI, true) ctx.strokeStyle = "rgba(120, 160, 180, 1)" ctx.stroke() // text ctx.font = "40px New Times Roman, sans-serif"; ctx.fillStyle = "rgba(160, 100, 160, 1)" ctx.fillText("Santell Atiba", 285, 600); ctx.fillText("Assistant Professor Dr. Zhanping Liu", 110, 650); ctx.font = "40px Ariel, sans-serif"; ctx.fillStyle = "rgba(250, 0, 120, 1)" ctx.fillText("KSU graphics project 2015", 160, 450) 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156
Figure 1. Example (snippet) of the Java Script code utilized to generate final product.
## Results and Discussion The results of the research generated the skills to be able to create graphics as well as a new, higher understanding of what graphics really are. Graphics are not only 3D images; they are a representation of a series of commands that tell the computer how to bring the graphic into existence. So, the word graphics refers essentially to the way images are made. Take a look back to old video games like the first Mario games and recall the pixelation. So that means the graphics were really bad right? Those are not graphics in the technical sense as they are just images put together pixel by pixel. Graphics are made, not by editing pixel by pixel, but using a script to edit and change many pixels into what you want while accommodating many simultaneousness requirements. I utilized the JavaScript programming language to create graphics. I wrote and edited the source code of the image within the Firefox Java Script interface, which was a long and demanding learning experience. I learned that syntax is essential, as the code does not execute with any typographical errors within the code. One space where it doesn’t belong or one lower case letter when it’s supposed to be capital could ruin the entire image, if it was generated in the first place. Another outcome is the illustration of the importance of making one change at a time so you can easily amend if the code fails. It’s also very important to do things in a certain order ===== PAGE 53 ===== or else everything else will not come together in a standardized and clear way. Another advantage of this process is that it helps me to remember the order of operations in activities not directly related to computer code programming. ## Future Plans Later I plan to continue writing code and creating graphics using Java Script and other similar programming tools. Future areas of focus involve the recreation of drawings using code scripting. This would increase my own skill as well as my understanding of JavaScript coding and enhance the utility of this skill for everyday problem solving. Overall, this experience has helped me toward my goals in computer science and I will continue to pursue these same goals and activities.
Image
Figure 2. Final graphic generated for project.
## References Analysis: The Exploding Demand for Computer Science Education, and Why America Needs to Keep up - GeekWire. GeekWire. N.p., 06 June 2014. Web. 26 June 2015. In the Year 2016: The 30 Fastest-growing Jobs. Boston.com. The New York Times, n.d. Web. 26 June 2015. ## Acknowledgments Thanks to Dr. Zhanping Liu for his mentorship, time, and effort with this project. Also, thanks to Program Director Dr. Buddhi Gyawali for creating the opportunity to participate in the SAP. ===== PAGE 54 ===== # Computer Programming (Scripting and Coding) Dillon Howard, Sophomore, John Hardin High School, Kentucky Dr. Chi Shen, Associate Professor and Interim Chair, Computer Sciences Dr. Jens Hannemann, Assistant Professor, Computer Sciences
Image
## Abstract For my research project, I was paired with Dr. Chi Shen for the Computer Science and Programming research team. We built a website through HTML (Hypertext Markup Language) to display our experience here in the SAP program. We also used a computer programming site called "Scratch" to create stories, animations, and games to understand the basics of coding and scripting. Our project was to script and code a video game. ## Introduction Within the next year, 2016, over four thousand jobs will be available within the computer science field (GeekWire). Our objective was to simply use script and code to make a video game with the beginning knowledge of programming we possessed. This past week and a half, it's been a pleasure working with Dr. Chi Shen and Dr. Jens Hannemann to enhance my knowledge in computer programming and problem solving throughout the process of creating the game. We used a programming website called "Scratch" to build the video game, while the web-based hypertext markup language interface was used to generate space for posting SAP material such as pictures and text. These tools are free and openly available to the public for research and non- ===== PAGE 55 ===== profit purposes, therefore they are a good choice for developing products that can shared with other users. ## Materials and Methods 1. Computer using the window operating system and browser interface 2. Notebook for planning and plotting the scripts before implementation 3. Web-based programming generation tool known as “Scratch” ## Results and Discussions In the first stages of building the website, I found out it takes patience and perseverance to build one correctly and accurately. I changed my idea for the video game multiple times. I came up with the idea to build a platform style video game and it actually turned out pretty good. The objective of the game is to get across all the obstacles and reach the edge of the screen where the light greenish color is. Once you touch the green, a tag will pop up and say "Congratulations, You Win!"
Image
Figure 1. Example scene constructed during the project.
===== PAGE 56 ===== ## Future Plans In the future, I plan to work with more Computer Programming Languages such as JavaScript, Python, and C++. I want to enhance my knowledge in the Computer Science field and I plan to study Computer Science in college. ## References "Analysis: The Exploding Demand for Computer Science Education, and Why America Needs to Keep up - GeekWire." GeekWire. N.p., 06 June 2014. Web. 26 June 2015. "In the Year 2016: The 30 Fastest-growing Jobs." Boston.com. The New York Times, n.d. Web. 26 June 2015. ## Acknowledgments I would like to truly thank Dr. Chi Shen and Dr. Jens Hannemann for helping complete this research project. I would also like to thank Jeremy Sandifer, Dr. Gyawali, and the NSF-HBCU-UP for the opportunity to participate in the SAP. ===== PAGE 57 ===== # Processing and Transmission of Environmental Data Leah Jackson, Junior, Edison High School, California Dr. Jens Hannemann, Assistant Professor, Computer Sciences
Image
## Abstract This project involved the taking of information from the Kentucky State University (KSU) Research Farm to generate data and developing code to process and visualize the data. Other activities involved the development of code for formatting the data and generating networks for making the data and outputs publicly available online via the internet. ## Introduction Why is programming and networking important? How do you share data? What other programs do you use on a daily basis? Technology now-a-days is becoming increasingly important. With increased use in technology, comes an increasing demand for the programming of these devices and the development of the code needed to do these things. With programming there are a lot of things that can go wrong and data can get lost, but there are programs that have been developed to help avoid many of the pitfalls and issues common to code development. Additionally, there are many tools that help share the data processed in the project online. ## Materials and Methods Why is computer programming and networking important? Programming and networking are important because networking creates the pace for users to be able to store and use their data in both private and public places. An important component to keeping the data available to the ===== PAGE 58 ===== rightful user is the IP Address that allows computer to identify and communicate with one another. Programming is important because it is important to know how to make codes for your computer, to create games and information, and to share this with a wide audience online. We utilized Python 3.4 to transfer the data from one computer to the other and the utilized Source Tree to help us track and share the data with other users making the collaborative project run smoothly. ## Results and Discussion How do you share data? When we share our data we used Source Tree to upload and then download from another computer or partner connected to the same server. At first this project was a bit frustrating, but once Kierra and I got the hang of things we were off and running. The networking part was a little hard and time consuming because if you mess one simple thing up you have to start all over again until you get the code right. The sharing techniques were easily implemented. You have to explain what you are doing every time you write a new code through embedded comments to aid the end users reached through the Source Tree network. ## Future Plans In the world of business this could be useful to know the programs that could help network, help other computer science professionals and consumers learn what the newest programs are and what works the best. When making the product, or in this case data, we have to make sure that we miss no steps and make no errors in creating the information that we or others may be using for the research. ## References "A Free Git & Mercurial Client for Windows or Mac." Free Mercurial and Git Client for Windows and Mac. N.p., n.d. Web. 26 June 2015. "Learn How to Program!" N.p., n.d. Web. 26 June 2015. "Python 3.4.3 Documentation." Overview —. N.p., n.d. Web. 26 June 2015. "Welcome to Python.org." Python.org. N.p., n.d. Web. 26 June 2015. Wikipedia. Wikimedia Foundation, n.d. Web. 26 June 2015. "Welcome to Python.org." Python.org. N.p., n.d. Web. 26 June 2015. ## Acknowledgements I thank all of the KSU organization for giving us these opportunities to pursue what we are interested in doing both in our upcoming college careers and in our dreams. ===== PAGE 59 ===== # Computer Science Mia Mays, Junior, Mercer County Senior High School, Kentucky Dr. Chi Shen, Associate Professor and Interim Chair, Computer Sciences
Image
## Abstract My project was done to show the importance of computer science, including C++ and a web-based programming interface called scratch. Before starting the code development, we went over the basics of computer programming and learned about different programming languages. After being introduced to scratch, I was given the choice to continue with programming or developing a game using scratch. I chose to make a game to show how it could be useful for others and to highlight the skills needed. I then came up with different game ideas including games geared toward education. I learned to develop all the different scripts needed and other useful skills such as planning and designing the code before implementation. I ended up with a successful game with only a few bugs that are being corrected. ## Introduction In today's world, it can often be assumed that making a game is easy, but as I have figured out throughout this process, it is far from easy. I’ve learned a lot about many different ways to create games, websites, and using C++. My main focus has been on working on my own game developed using many different methods and tools to complete the project. To create my game I used a website called scratch, which allows you to create your own games, animations, and stories. I chose to make an educational game, which allows students to learn multiplication in fun way to encourage continued use. ===== PAGE 60 ===== ## Materials and Methods The only materials I used to make my game were the computer and associated software. The first step was creating my own account on scratch. I next chose a backdrop and a sprite. A sprite is the object/character used when you play the game. I then had to choose an event and date script. While choosing my data script I had to learn what a variable was and how to use one. A variable is what contains numbers, texts, and Booleans (true/false). I also used the operations, motion, looks, and sound scripts. The operations allow me to enter problems like 3 × 6 and the program would return the correct answer. The motion script allowed me to give my sprite any movement I wanted. I used the look script and gave my sprite a word box. You can also use it to change the color of your sprite. The sound script allows you to give your sprite sounds. Each of these features was used to develop the game.
Image
Figure 1. The Scratch programming interface environment contains the scripted scene, script tool options, and lavout workspace is shown from left to right.
## Results and Discussion and Future Plans My project showed how computer programming is more important than others may think. Computers are mostly used for work purposes, such as, creating websites and computer systems. Eventually most jobs are going to be based on computers and computer programming, which is why it's so important for us to learn about computer science now. I decided to show that going ===== PAGE 61 ===== into game making is not pointless, rather, games allow your mind to stay sharp as you get older. They also help with mental acuity between games. You can create games that help stimulate your mind or even help you study for text. The game I developed helps children learn multiplication in a more fun way that increases their chance for success. Young children often don’t like to learn addition, subtraction, nor multiplication on paper of flashcards because it gets boring. Why not be able to play many different games on the computer, tablet, smart phone, or iPad? After working with the many different websites and programming sites I hope to continue learning more about computer science and to continue creating many different games and websites. I would like to learn more about C++ and learn more about different programming languages. I could also work more on the game I have already created to make it more professional. ## References "Analysis: The Exploding Demand for Computer Science Education, and Why America Needs to Keep up - GeekWire." GeekWire. N.p., 06 June 2014. Web. 26 June 2015. "In the Year 2016: The 30 Fastest-growing Jobs." Boston.com. The New York Times, n.d. Web. 26 June 2015. ## Acknowledgements I would like to thank Dr. Shi Shen for her time and effort with this project completing this project. I also want to thank Dr. Buddhi Gyawali for providing the opportunity to participate. ===== PAGE 62 ===== # Processing and Transmission of Environmental Data Kierra Scott, Sophomore, Kentucky Country Day School, Kentucky Dr. Jens Hannemann, Assistant Professor, Computer Sciences
Image
## Abstract The purpose of this project was to transfer information from a removable disk to the memory of another computer and then to analyze the information using the program Source Tree. On Source Tree, the objective was to be able to work on the same document and then seamlessly combine the works that Leah and I had completed at the end. Using the Python programming language, we developed computer to visualize the data in graphical medium. ## Introduction Saving information is very critical, especially when working with computers for long periods of time or during many different periods. Some believe that using a removable disk is the best solution, while others believe saving to the computer's local hard drive is the best idea. But I found through analysis that transferring information from the removable disk to the computer's memory is the best way to go. No more transferring files from program to program, no more trusting the USB or desktop to save our information. Using a program called Source Tree is definitely the best way to get you started on transferring data for good via the cloud. This paper will thoroughly explain the process of saving this information to a computer's memory and making it available via online sharing. ===== PAGE 63 ===== During the course of the project, we were able to successfully transfer data onto the computer’s memory so that the information wouldn’t be erased or altered in any way. At first, we had many complications with writing the code, but as we continued to develop our skills, the complications and errors became less and the codes would run with greater ease. Among the many important things we learned were that coding is very tedious and you have to pay careful attention to everything that you are putting into that specific coding program. Mistakes that are coded using Python, for example, can be very hard to identify and correct if the debugging features (figure 1) in Python were not robust. Once the code was completed, the data we had collected was visualized using two different types of graphs. Low-resolution graphs were created to conserve data bandwidth when sharing, while high-resolution graphs were created for publication. Traceback (most recent call last): File "C:\Users\leah.jackson\Desktop\env-data\python\analyze.py", line 4, in import matplotlib ImportError: No module named 'matplotlib'
Figure 1. The “error traceback” messaging feature within the Python scripting shell environment is very useful for highlight code errors. This message is generated anytime a syntax error is committed.
## Methods and Materials To be able to save digital information properly, the following items are needed: a computer, the latest version of Python IDLE, the program SourceTree, and plenty of time because this process can take a lot of it. Using Source Tree, we can share the changes made on the document with our peers and vice versa. In order to save the information without someone getting to it and altering it, we would use PuTTyGen to generate either a public or private key to control access. Generating the private key will assure that any information on there will not be accessed by anyone else other than the owner or permitted user. When making changes to the information, we would have to commit those changes and then proceed to push the changes, which our peers would then pull to have changes saved to their version of the file. One good thing about Source Tree is that even if the changes are deleted from the person's computer it is still saved to Source Tree as a backup for emergencies. ===== PAGE 64 ===== ## Discussion Using this technology will be very beneficial in the career fields that I am planning to go into. For Nursing, this program will be very beneficial because in the case that I was a nurse and I worked at a hospital, of course there are a lot of patients that come in and out every day, so to have this program on the computer in a simplified form so that when the nurses may enter the information into the computer system and keep a lot of information there. In the field of Psychology, this would be beneficial because if there is information that needs to get from one psychologist to another on the other side of the country instead of I being faxed or emailed the group of psychologists can work on it together with ease. The programs that I used include: • Notepad • Python 2.7(IDLE) • Python 3.2(IDLE & Command Line) • Python 3.4(IDLE) • SourceTree www.inventwithpython.com www.python.org ## References "Analysis: The Exploding Demand for Computer Science Education, and Why America Needs to Keep up - GeekWire." GeekWire. N.p., 06 June 2014. Web. 26 June 2015. "In the Year 2016: The 30 Fastest-growing Jobs." Boston.com. The New York Times, n.d. Web. 26 June 2015. ## Acknowledgements I am definitely blessed to be able to have this opportunity and be able to experience this camp with a great group of peers and a great staff here helping me every step of the way. I am also so thankful to my parents and my brother for helping me with preparing for this camp. ===== PAGE 65 ===== # Balancing a Video Game Malik Walls, Junior, Jeffersontown High School, Kentucky Dr. Jens Hannemann, Assistant Professor, Computer Science
Image
## Abstract My research project involved video game development and balancing. The process involved creating a typical game level so that no player would find it too easy or too hard. First I had to conduct an experiment to see what type of game would be popular. Next, I started to fiddle with the source code to make it comfortable and enjoyable for the player. Then, I got my participants to test out the game for five iterations. After each trial I changed the source code to modify the game difficulty without alerting the players. When each subsequent trial was over I asked them to rate the difficulty on a scale 1-5 with one being the easiest, and 5 being the hardest. I had a sample size of 10 people to participate and generated enough feedback to create a histogram visualizing the results. Results of the survey indicate that my game was balanced. ## Introduction When it comes to creating a video game it’s not as easy as people might think. It requires a lot of time, dedication, and patience in order for the game to be playable. A video game involves manipulating images produced by a computer program that can be further manipulated based on player input or feedback. A video game is controlled by a source code developed using a programming language, in this case, Python. This code can be used to control all details including imaginary characters, the motions of the characters, the objectives of the game, and most importantly, the player’s experience with the game. ===== PAGE 66 ===== ## Materials and Methods I used a computer to connect to the version control system, to create a storage place to save all my data, and develop the code from our class game. The computer was mainly used to get input on our game and to assess the perceived difficulty of the game. I created a survey sheet to get people to rate the difficulty of the first level of our game. Once the survey was created, I started to search the campus for volunteers to play and test the game difficulty. After I got my data I used Microsoft Excel, to create a value histogram to show the results of the experiment.
Results and Discussion
Image
Figure 1. Perceived difficulty as a function of the player's bullet speed
Of the 10 people that tested the game out, only approximately 25% of them thought the game was too easy and suggested the difficulty level should be a bit harder. The rest of the participants thought the game difficulties were in the middle range, not too easy or not too hard. Because most of them thought the games were of medium difficulty, the game was balanced. This is shown by the symmetrical histograms in Figure 1 and Figure 2 that displays a normal curve. Most of the participants started to like the game at a more difficult level because it made the game more of a challenge and therefore, more fun or slightly addicting to them. Although the game was mostly rated as fun, some of the participants thought the game was very difficult. ===== PAGE 67 ===== and became aggravated with repeated tries. Overall, the success of the project was the completed game was balanced in difficulty.
Image
Figure 2. Perceived difficulty as a function of the aliens' bullet speed
## Future Plans This experiment can be modified for the future by adding more difficulty levels and getting more people to test out the game. With this change, the outcome will be different because it's more than one level. Because it has more than one level, I can now create different settings for each level. ## References "Analysis: The Exploding Demand for Computer Science Education, and Why America Needs to Keep up - GeekWire." GeekWire. N.p., 06 June 2014. Web. 26 June 2015. "In the Year 2016: The 30 Fastest-growing Jobs." Boston.com. New York Times, n.d. Web. 26 June 2015. ## Acknowledgments I am really grateful for Kentucky State University giving me the opportunity to participate in the SAP program. My mentor Jens Hannemann, was very helpful when it came to my research assignment. He provided me with the information and guidance to help me finish my project on time. Dr. Jens was really inspiring and helpful to me during my time at the SAP program. ===== PAGE 68 ===== Geographic Information Sciences ===== PAGE 69 ===== Using Geo-Spatial Technology to Identify Urban Heat Jalen Austin, Sophomore, Southern High School, Kentucky Jeremy Sandifer, STEM Project Coordinator, CAFSSS Dr. Buddhi Gyawali, Assistant Professor and SAP Director, CAFSSS
Image
## Abstract Urban heat islands continue to cause problems for cities and health concerns for the residents of these areas. This project utilizes the mapping capabilities of geographic information system for combining various environmental data to assess the impact land cover distribution has on the expression of increased urban heat. ## Introduction The urban heat island is a general term used to describe the relative temperature difference between the surfaces of the inner city and surfaces in the surrounding rural areas. My team of researchers were given the following questions: What are Urban Heat Islands? Do they really exist? What is the driver of this condition? How can we prevent or mitigate them? Our answer is the use of geo-spatial technology to collect environmental data that shows the distribution of urban heat and the factors that correspond to this condition. The chart below shows how heat related death rates have increased over time illustrating the severity of heat issues and how it is increasingly a major problem. How can we prevent or stop this? The answer is, by using brighter materials for housing and buildings so that instead of absorbing and storing heat, it is reflected back to the atmosphere. Another option is demolition of unused structures and ===== PAGE 70 ===== creation of more forested areas within the urban areas. Because the trees absorb light energy to create food and expel latent energy from their leaves (transpiration), they help reduce the overall heat load of the area. What makes this condition so bad? Heat, a leading killer in the nation as the heat stores up in surfaces like asphalt, the temperature of the area remains elevated, even at night. This deprives the human body of the ability to cool down and increases the risk of illness. Another problem made worse is the creation of smog components. Smog is created when chemical elements common to the urban environment and heated causing an increase in the reactivity of these components, leading to enhanced smog formation.
E
Image
Figure Sources from DigitalOctober, Geoliye, Farthstar Geographics, CHERAirbus CS, USCA, USCS, AEA, Geolimapping, Aerogrid, ISH,
Methods
We began our research in the lab-resourced with high speed computers and the latest updates of geographic information software programs. Also we were introduced to a new suite of programs known as ArcGIS. We used ArcMap to create maps such as Figure 1 to identify which areas are warmer than others and what environmental conditions corresponded with these increased temperatures. The primary condition investigated was the land cover distribution that was pre-classified within the National Land Cover Dataset from the USGS. These data were ===== PAGE 71 ===== overlaid to compare the spatial distribution of each to judge the impact of land cover on urban heat. ## Results Looking on the map above (Figure1), you can see that the interior portions of the city of Valdosta, Georgia are much warmer than the surrounding rural areas. In some cases, this difference is as high as 15 degree Celsius. The inner city land cover is dominated by areas of dense impervious infrastructure, such as roads and buildings, while the surrounding areas are much more forested and so cooler as a result. Since the distribution of dense urban land cover is spatially correlated with the distribution of increased temperatures, it is clear that land cover is a dominant driver of heat in this location. ## Future Plans We can use technology to see what areas should have factories and still be able to keep the balance of heat without creating local climate changes. This would help our urban planners better manage this important health and environmental issue. This can show us what areas are best to create new farms or forest and the impact of this land cover change can be modeled before any cost and construction. I plan to continue with this project using higher spatial resolutions of thermal data to get a closer look at surface conditions related to urban heat. ## References Oke, T.R. and J.A. Voogt. (2003) Thermal remote sensing of urban climates. Remote Sensing of Environment, 86, 370-384. Stone, Jr., Brian. (2007) Short Communication: Urban and rural temperature trends in proximity to large US cities: 1951-2000. International Journal of Climatology, 27, 1801-1807. Environmental Protection Agency (EPA) Website. The Urban Heat Island. http://www.epa.gov/climatechange/science/indicators/health-society/heat-deaths.html Last accessed June, 2015 ## Acknowledgments I would like first to thank Dr. Buddhi Gyawali for giving me the chance to come out to Kentucky State University and live the college life for 3 weeks and gain exposure to the STEM program. I would also like to thank Jeremy Sandifer, Kolan Livingston, and the other members of our research team for the assistance with the project. Last, but not least, I would like to thank my mom because she pushes me when things get tough in life. Love you mom. ===== PAGE 72 ===== # The Connection Between City Layout and Urban Heat Islands Cole Brewer, Junior, Model Lab, Kentucky Jeremy Sandifer, STEM Project Coordinator, CAFSSS Dr. Buddhi Gyawali, Assistant Professor and SAP Director, CAFSSS
Image
## Abstract Urban Heat Islands are areas of relatively increased heat centered on urban areas versus the surrounding rural areas. This experiment was done to see if there was any relation between a city's layout of land cover features and the distribution of the Urban Heat Island. Various data maps were analyzed and compared in the ArcMap program, eventually bringing the group to the conclusion that the city's layout and land cover determined the shape and intensity of the urban heat island. ## Introduction Most modern-day cities suffer from a phenomenon known as the Urban Heat Island. As a city grows, it begins to replace the natural, permeable soil and foliage with concrete buildings and asphalt roads. These new surfaces absorb heat better than before, and begin to radiate this heat into the air around them and causing an increase in local air and surface temperatures. This creates an effect known as the Urban Heat Island, where urban areas tend to be relatively warmer than the surrounding rural or forested land, as can be resolved in Figure 1. Heat islands can increase air pollution and lower quality of life. Each city's heat island is different, and we wanted ===== PAGE 73 ===== to learn why. Is there any difference based on the original climate? Is it the city itself? We set out to answer that question.
Map of the Syracuse Urban Heat Island
Image
Figure 1. The distribution of urban heat is correlated with the distribution of impervious developments compared to the cooler, and more forested, rural areas.
## Materials and Methods GIS (Geographic Information Systems) is using cartographical data to measure things such as climate, rainfall, or ambient temperature or humidity. Cartographical data can include heat maps, land cover databases, rainfall patterns, and so on. Most GIS data comes in the form of raster and vector data. Rasters are dot matrixes –similar to pixels- while vectors are made of shapes and lines. Some of the most useful modern GIS data comes from space-borne satellite ===== PAGE 74 ===== systems such as the MODIS instrument. MODIS takes high temporal resolution images of the earth's surface with a pixel resolution of 1,000 meters square. We also took a look at temperature differences between different areas of the eastern US to compare the conditions associated with varying levels of increased heat. Each one of us measured the size of the heat island itself, the distribution of temperatures, and its relation to the layout of the city. Then we calculated the difference in temperatures between the heat island and the surrounding area. For example, I found a 3-degree difference between Syracuse, NY and its surrounding land. ## Results and Discussion Every city we studied had a detectable heat island covering it. The size and shape of an Urban Heat Island is based directly on the layout of the urban area it is attached to. A more forested area would tend to be cooler than a group of office buildings, for example. Variation based on climate was not expected because most of the cities were in similar climatic contexts. The Urban Heat Island is most directly connected to the physical layout of the landscape. The increase in temperature is due to the urban land cover affecting the landscape. Thus, the layout of the city and its land cover is the dominant driver of the heat island. ## Future Plans In the future, similar studies could be performed to find areas of interest on other planets-areas with a higher than normal temperature. This has already been done on the moon and on Mars, but it could be used further for finding a new cracks in Europa's icy crust or locating high intensity storms on Jupiter and Saturn. This could provide valuable scientific data, and expand our knowledge of our solar system further. ## References Oke, T.R. and J.A. Voogt. (2003) Thermal remote sensing of urban climates. Remote Sensing of Environment, 86, 370-384. Stone, Jr., Brian. (2007) Short Communication: Urban and rural temperature trends in proximity to large US cities: 1951-2000. International Journal of Climatology, 27, 1801-1807. Environmental Protection Agency (EPA) Website. The Urban Heat Island. http://www.epa.gov/climatechange/science/indicators/health-society/heat-deaths.html Last accessed June, 2015 ## Acknowledgments I would like to acknowledge the organizers of the Summer Apprenticeship Program for creating the opportunity to participate in such an exciting program. ===== PAGE 75 ===== Urban Heat Islands Maya Jackson, Junior, Edison High School, California Jeremy Sandifer, STEM Project Coordinator, CAFSSS Dr. Buddhi Gyawali, Assistant Professor and SAP Director, CAFSSS
Image
Introduction
What is the Urban Heat Island? Urban Heat Islands are relatively warmer areas in the inner city that are caused by human activities. Urban heat Islands are very important because they play an important role in the quality of our environment. Urban heat islands can affect many things such as growing conditions of vegetation and human health. It affects us in the summertime because it increases summertime temperatures (EPA 2015) and can lead to heat related illnesses during heat waves. ## Materials and Methods For this project we looked at different places to observe the relative distribution of increased temperatures. We used ArcMap to combine various environmental data to assess the degree to which the temperature distributions match the local distribution of impervious urban developments. We also made thermal maps that showed us urban and rural temperatures and calculated the difference between each to define the urban heat island magnitude. The team also looked at land cover distributions (Figure 1) to try and explain its relationship to urban heat distribution (Figure 2) derived from MODIS satellite imagery. ===== PAGE 76 =====
Image
Figure 1. Land cover distribution in 2011 for Lexington, Kentucky according to the USGS National Land Cover Dataset (NLCD)
Image
Figure 2. Distribution of urban surface heat appears to coincide with the distribution of urban impervious surface land cover types (Credit: Kolan Livingston 2015).
## Results and Discussion The team of researchers discussed why urban heat Islands are different in different cities. They are different because all the different cities have different compositions of building ===== PAGE 77 ===== materials interspersed with natural vegetation. We found that the hotter areas are more likely to have greater densities of impervious infrastructure such as roads and buildings that store and reradiate daytime heat energy. The surrounding areas tend to be cooler due to the widespread distribution of forested areas that reduce heating through shading and transpiration. This effect was detected in essentially all areas investigated, proving that this is modern on-going environmental concern. ## Future plans These environmental issues of urban heat can really have an effect on many different communities in many different places. So by testing more problems and proving many different hypotheses regarding land cover distribution can eventually find ways for scientists to stop urban heat islands from creating higher temperatures while allowing for continued smart development. Scientists that actually use GIS mapping could go out and use many different datasets to further investigate urban heat islands and their drivers and impacts. ## References Imhoff,, Marc Ping Zhang, Robert Wolfe, and Lahourari Bounoua (2010) Remote sensing of the urban heat island effect across biomes in the continental USA. Remorte Sensing of Environment, 114, 504-513. Oke, T.R. and J.A. Voogt. (2003) Thermal remote sensing of urban climates. Remote Sensing of Environment, 86, 370-384. Stone, Jr., Brian. (2007) Short Communication: Urban and rural temperature trends in proximity to large US cities: 1951-2000. International Journal of Climatology, 27, 1801-1807. Environmental Protection Agency (EPA) Website. The Urban Heat Island. http://www.epa.gov/climatechange/science/indicators/health-society/heat-deaths.html Last accessed June, 2015 ## Acknowledgments I want to thank the organizers of the SAP program for creating these great experiences. I would especially like to thank Dr. Gyawali for inviting me to come participate in the Summer Apprenticeship Program. It was a great learning experience to prepare for college. I would also like to thank all the participants because they were all good friends to me during this experience. ===== PAGE 78 ===== Urban Heat Island Phenomena Kolan Livingston, Junior, Wyoming High School, Ohio Jeremy Sandifer, STEM Project Coordinator, CAFSSS Dr. Buddhi Gyawali, Assistant Professor and SAP Director, CAFSSS
Image
## Abstract An Urban Heat Island (UHI) is an area within a city that has significantly warmer temperatures than its surrounding rural areas due to human activities. The causes of UHI vary with location and can be traced to man-made activities such as built structures within urban areas that provide multiple surfaces for the reflection and absorption of sunlight, increasing the efficiency with which urban areas are heated. Others cause an include the reflection of the sun and absorption of long-wave radiation that is retained within concrete and asphalt compared to rural areas with more forested areas that are cooled by shading and transpiration. Thus, the main differences between the UHI in cities is the level of urban development, such as the number of buildings, miles of paved roads, and number of forested areas. ## Introduction What is an Urban Heat Island (UHI) and why is it called that? An Urban Heat Island is an area that is significantly warmer that it's surrounding rural areas due to human activities such as land cover conversion and electricity generation. What is the primary cause of the UHI? Many buildings found in urban areas have smooth hard surfaces that effectively trap solar energy and eradicate this energy so that the air and surface adjacent are heated. In contrast, brightly colored and pervasive surfaces are cooler and contribute less to the UHI magnitude. Due to the ===== PAGE 79 ===== absorption and retaining of the heat the man-made structures -- roads, parking lots, and buildings serve as a heat source. Releasing the energy slowly into the atmosphere raises the temperature of those surfaces and the air in contact with them, creating an urban heat island. As the day progresses, a dome of warm air forms over the city as convection transports heat from the surface to higher in the atmosphere. Even after the sun goes down, the temperatures do not drop quickly and stay higher than other areas with trees and natural surroundings such as open fields, forest or vegetated areas that surround larger urban areas. The UHI effect does not allow for the natural dropping of temperatures at night and causes human illness as a result. Below is a pictorial view of what happens (W1).
Image
Figure 1. Conceptual model of the urban heat island phenomena (W1) Materials and Methods
Strategies to fight UHI include giving urban buildings reflective or “green” roofs that can cut down on UHI. Creating green spaces within cities will help in reducing the effects of UHI. These spaces would include trees, vegetation, roof top gardens that will help to reduce heat absorption and ultimate reducing the overall temperature. Another focus should be on reducing the introduction of asphalt and concrete by incorporating more green spaces to shade surfaces and improve quality of the life in urban areas. ===== PAGE 80 =====
Image
Figure 2. Urban heat distribution in Cincinnati, Ohio derived from MODIS satellite imagery.
## Results and Discussion Elevated temperature from UHIs, particularly during the summer and at night, can negatively affect a community's natural environment and quality of life. One way that higher temperatures of the UHI's can affect air quality is by increasing ozone pollution, commonly known as smog. It was cited previously that an average of 1,000 people die each year due to extreme heat and some of this increase is due to elevated temperatures. UHI can prolong the intensity of the heat and deprive city residents of the cooling that is typically experienced during the night, thus playing a role in the annual death toll. Changes as little as white paint on surfaces can be used to reduce the effects of UHI. The green space addition, roof top gardens, changing building materials can reduce the overall heat load of the urban area, especially when incorporated alongside tree canopy restorations. These strategies can begin to reduce the temperatures and assist in improving the health of those living in urban areas impacted by the temperature increases of the UHI phenomenon. ===== PAGE 81 =====
Image
Figure 3. Distribution of impervious land covers is highly correlated with the distribution of increased surface heat within the urban environment.
## Future Plans UHI has been indirectly linked to global climate change due to its contribution to the greenhouse effect. As the world focuses more on global warming, UHI will become more important as cities will be searching for ways to solve their local health issues and looking for ways to reduce pollution, reduce temperatures and fighting smog. The above strategies should be used to mitigate UHI and I will continue to investigate their implementation using GIS. ## References Changnon, S.A., K. E. Kunkel, and B. C. Reinke (1996) “Impacts and responses to the 1995 heat wave: A call to action”. London “US Environmental Protection Agency” EPA. Environmental Protection Agency, n.d. Web. 24 June 2015 ## Acknowledgements W1. WeatherQuestions.com, Web. 26 June 2015. Accessed June 2015. Many tanks to the organizers of the Summer Apprenticeship Program for creating this unique research experience and opportunity. ===== PAGE 82 ===== Urban Heat Island in the USA Tyrus Sundy, Junior, Carter G. Woodson Academy, Kentucky Jeremy Sandifer, STEM Project Coordinator, CAFSSS Dr. Buddhi Gyawali, Assistant Professor and SAP Director, CAFSSS
Image
## Abstract Urban Heat Island is an urban area that has a higher temperatures compared to the surrounding rural areas. For this project, I mapped out the urban heat island in Lexington, KY. I mapped the land cover and the surface urban heat island to assess the correlation between them. I found that Lexington is a unique place because there is a little part of the downtown area where there is rarely UHI and the overall structure of the UHI is contained within the development limited areas. What I learned is that Urban Heat Island actually exists in essentially all locations with development and there are many ways to decrease the intensity of the condition through smart construction and natural conservation. ## Introduction Our natural environment is the primary source of the energy and materials we use every day. Stated simply, we cannot live without it. In addition to anthropogenic carbon dioxide releases, water and air pollution, climate change, high rate of natural disasters, the urban heat island is a man-made phenomenon with potentially dangerous impacts. The urban heat island is phenomena where an area is significantly warmer than its surrounding rural areas, primarily due to conversion of naturally vegetated area to areas of impervious development. UHIs occur due to increases in urban infrastructure that drives increases in the amount of solar energy stored in the daytime and subsequently released during the nighttime hours, causing increases in local air and ===== PAGE 83 ===== surface temperatures. Some of the specific activities that drive the UHI include the composition of the dark building materials we use to construct the city and the lack of incorporated green spaces. Another thing is that bright surfaces such as concrete tend to create convection into the air that can potentially create more extreme weather in addition to increased temperatures. The research question here involves whether the Urban Heat Island actually exists and what is the primary driver of the condition (Figure 1).
Image
Figure 1. The Urban Heat Island in Lexington, Kentucky, as seen from space. The highest temperatures are denoted by the lighter colors and correlate with impervious land covers.
## Materials and Methods This research was mostly about using geospatial technology to monitor and quantify changes to the natural environment and correlate these changes to the distribution of urban heat. We used ArcGIS to create maps in the eastern United States, which contains the most urban heat islands. Using ArcGIS and many environmental datasets, my group figured out if urban heat island actually existed in essentially all locations. Here, the relative magnitude of the UHI is a measure of the potential difference between the urban and non-urban areas of a particular city, as illustrated in Figure 1. For example, the city of Chicago has a greater UHI. ===== PAGE 84 ===== signal than the city of Phoenix, but only because of the variation of land cover from built to forested, relative to the homogenous bare soil land cover in Phoenix. While Phoenix is hotter in absolute terms, the relative temperature difference between urban and non-urban Chicago is far greater. Lastly, we assessed the land cover distribution of each location using the National land Cover Dataset (NLCD), shown in Figure 2, to see if variation in cover percentages were correlated with the urban heat distribution.
Image
Figure 2. Land cover distribution in 2011 for Lexington, Kentucky according to the USGS National Land Cover Dataset (NLCD). Impervious areas correlate with increased temperatures.
## Results and Discussion We can say that the magnitude of urban heat island is different across locations because of the physical differences in land cover composition. As proof we see the distribution of the land cover follow the same spatial patterns as the distribution of the increased temperatures. For example, the highest temperatures were in the land covers dominated by high-density impervious developments while the lowest temperatures were in the forestland covers of the surrounding ===== PAGE 85 ===== rural areas. It is reasonable to conclude that the higher the portion of impervious developments, the greater the magnitude of the UHI effect. It follows from this observation that the best potential tactic for combating the UHI involves restoration of the tree canopy to increase shading potential and restore transpiration processes. ## Future Plans What can we do is to install cool, reflective roofs, use cool pavements, create green roofs, increase vegetative cover, and increase tree growth to mitigate the UHI effect. I will continue to use the power of GIS to monitor and analyze changes to the land cover and subsequent impacts to the distribution of urban heat. ## References Oke, T.R. and J.A. Voogt. (2003) Thermal remote sensing of urban climates. Remote Sensing of Environment, 86, 370-384. Stone, Jr., Brian. (2007) Short Communication: Urban and rural temperature trends in proximity to large US cities: 1951-2000. International Journal of Climatology, 27, 1801-1807. Environmental Protection Agency (EPA) Website. The Urban Heat Island. http://www.epa.gov/climatechange/science/indicators/health-society/heat-deaths.html Last accessed June, 2015 ## Acknowledgements I want to thank the organizers of the SAP program, including Program Director Dr. Buddhi Gyawali and STEM Project Coordinator Jeremy Sandifer. ===== PAGE 86 =====
Carter G. Woodson Academy
1813 Charleston Dr, Lexington, KY 40505
Christian County High School
220 Glass Ave, Hopkinsville, KY 42240
Edison High School
540 E California Ave, Fresno, CA 93706
Franklin County High School
1100 E Main St, Frankfort, KY 40601
Hales Franciscan High School
4930 S Cottage Grove Ave, Chicago, IL 60615
Jeffersontown High School
9600 Old Six Mile Ln, Louisville, KY 40299
John Hardin High School
384 W A Jenkins Rd, Elizabethtown, KY 42701
Kentucky Country Day School
4100 Springdale Rd, Louisville, KY 40241
Lake Wales High School
1 Highlander Way, Lake Wales, FL 33853
Ludlow Independent High School
525 Elm St, Ludlow, KY 41016
Mercer County High School
1124 Moberly Rd, Harrodsburg, KY 40330
Model Lab
521 Lancaster Ave, Richmond, KY 40475
Participating High Schools ===== PAGE 87 ===== Paul Laurence Dunbar High 1600 Man O War Blvd, Lexington, KY 40513 Phoenix School of Discovery 10200 Dixie Hwy, Louisville, KY 40272 Pleasure Ridge Park High School 5901 Greenwood Rd, Louisville, KY 40258 Presentation Academy 861 S 4th St, Louisville, KY 40203 Seneca High School 3510 Goldsmith Ln, Louisville, KY 40220 Southern High School 8620 Preston Hwy, Louisville, KY 40219 Spencer County High School 520 Taylorsville Rd, Taylorsville, KY 40071 Stivers School For the Arts 1313 E 5th St, Dayton, OH 45402 The Academy @ Shawnee 4018 W Market St, Louisville, KY 40212 Trinity High School 4011 Shelbyville Rd, Louisville, KY 40207 Waggenor Traditional High School 330 S Hubbards Ln, Louisville, KY 40207 Western Hills High School 100 Doctors Dr, Frankfort, KY 40601 Wyoming High School 106 Pendery Ave, Cincinnati, OH 45215