{ "document_id": 16824, "page": 48, "width_pt": 612, "height_pt": 792, "rotation": 0, "pipeline_version": "paddleocr-vl-1.6+paul-48", "engine": "paddleocr_vl", "source_run_id": 16935, "item_count": 32, "counts_by_type": { "caption": 1, "footer": 1, "form_field": 4, "heading": 2, "table": 1, "table_cell": 15, "text": 8 }, "build_ms": 4, "items": [ { "id": "p48.1", "order": 1, "type": "text", "bbox": { "l": 68.4, "t": 718.8, "r": 541.2, "b": 684 }, "text": "minute for 40 cycles, concluded by a final elongation at [p48.1.4]C for 7 minutes. The finished PCR were stored at [p48.1.5]C or [p48.1.6]C until gel electrophoresis.", "children": [ { "id": "p48.1.1", "order": 2, "type": "form_field", "bbox": { "l": 256.88, "t": 718.8, "r": 268.88, "b": 706.8 }, "text": "", "attrs": { "field_kind": "radio", "label": "C for 7 minutes. The finished PCR were stored at 4", "source": "glyph_estimate", "bbox_estimated": true, "text_offset": 14, "text_span": 0 } }, { "id": "p48.1.2", "order": 3, "type": "form_field", "bbox": { "l": 419.81, "t": 718.8, "r": 431.81, "b": 706.8 }, "text": "", "attrs": { "field_kind": "radio", "label": "C or -20", "source": "glyph_estimate", "bbox_estimated": true, "text_offset": 22, "text_span": 0 } }, { "id": "p48.1.3", "order": 4, "type": "form_field", "bbox": { "l": 448.56, "t": 718.8, "r": 460.56, "b": 706.8 }, "text": "", "attrs": { "field_kind": "radio", "label": "C until gel electrophoresis.", "source": "glyph_estimate", "bbox_estimated": true, "label_source": "parent_text", "label_ref": "p48.1", "text_offset": 66, "text_span": 0 } }, { "id": "p48.1.4", "order": 5, "type": "text", "bbox": { "l": 68.4, "t": 718.8, "r": 541.2, "b": 684 }, "text": "72^{\\circ}", "attrs": { "inline": true, "text_offset": 57, "text_span": 9, "bbox_estimated": true } }, { "id": "p48.1.5", "order": 6, "type": "text", "bbox": { "l": 68.4, "t": 718.8, "r": 541.2, "b": 684 }, "text": "4^{\\circ}", "attrs": { "inline": true, "text_offset": 115, "text_span": 9, "bbox_estimated": true } }, { "id": "p48.1.6", "order": 7, "type": "text", "bbox": { "l": 68.4, "t": 718.8, "r": 541.2, "b": 684 }, "text": "-20^{\\circ}", "attrs": { "inline": true, "text_offset": 129, "text_span": 9, "bbox_estimated": true } } ] }, { "id": "p48.2", "order": 8, "type": "text", "bbox": { "l": 68.64, "t": 677.04, "r": 543.12, "b": 577.92 }, "text": "For DNA isolated from the unknown ground meat samples, PCR amplifications were performed on following the same procedure above with the following changes; 2μl DNA template, 0.4μl Taq enzyme, 8.2μl deionized water, annealing at 59°C or 60°C for 1 minute, PCR was done in a genetics lab using pipette tips with aerosol barrier to minimize the risk of cross contamination." }, { "id": "p48.3", "order": 9, "type": "heading", "bbox": { "l": 70.08, "t": 571.68, "r": 175.92, "b": 558.48 }, "text": "Gel Electrophoresis", "attrs": { "block_label": "paragraph_title" }, "level": 3 }, { "id": "p48.4", "order": 10, "type": "text", "bbox": { "l": 68.64, "t": 551.28, "r": 543.36, "b": 431.28 }, "text": "Agarose gel electrophoresis was performed to analyze PCR results. 6μl 5x loading buffer was added to each PCR product, and the 26μl solutions were analyzed through gel electrophoresis on 2% agarose gel run in 0.5xTBE buffer at 80V for 1-2 hours. For the unknown meat samples, electrophoresis was done using 60V to increase resolution. The Promega 25bp DNA Step Ladder was used as size standard but the stock seemed to be degraded based on the later results." }, { "id": "p48.5", "order": 11, "type": "caption", "bbox": { "l": 70.08, "t": 411.36, "r": 489.36, "b": 398.4 }, "text": "Table 1. PCR oligonucleotide primers are shown along with target species and results.", "attrs": { "block_label": "figure_title" } }, { "id": "p48.6", "order": 12, "type": "table", "bbox": { "l": 65.76, "t": 397.68, "r": 510, "b": 257.04 }, "text": "", "attrs": { "block_label": "table", "n_rows": 5, "n_cols": 3, "integrity": { "cells_checked": 15, "cells_flagged": 2, "flags": [ { "row": 3, "col": 1, "coverage": 0.4, "text": "5' GCCTAAATCTCCCCTCAATGGTA 3'5' ATGAAAGAGGCAAATAGATTTTCG 3'" }, { "row": 4, "col": 1, "coverage": 0.4, "text": "5' TTAAAGACTGAGAGCATGATA 3'5' ATGAAAGAGGCAAATAGATTTTCG 3'" } ] } }, "children": [ { "id": "p48.6.1", "order": 13, "type": "table_cell", "bbox": { "l": 72.23988, "t": 397.572, "r": 143.20308, "b": 384.288 }, "text": "Target Species", "attrs": { "row": 0, "col": 0, "rowspan": 1, "colspan": 1, "bbox_refit": true, "column_header": true, "header_source": "pdf" } }, { "id": "p48.6.2", "order": 14, "type": "table_cell", "bbox": { "l": 161.0399, "t": 397.572, "r": 277.3307, "b": 384.288 }, "text": "Sequence of the primers", "attrs": { "row": 0, "col": 1, "rowspan": 1, "colspan": 1, "bbox_refit": true, "column_header": true, "header_source": "pdf" } }, { "id": "p48.6.3", "order": 15, "type": "table_cell", "bbox": { "l": 423.6, "t": 397.572, "r": 504.2484, "b": 370.608 }, "text": "Expected PCR results", "attrs": { "row": 0, "col": 2, "rowspan": 1, "colspan": 1, "bbox_refit": true, "column_header": true, "header_source": "pdf" } }, { "id": "p48.6.4", "order": 16, "type": "table_cell", "bbox": { "l": 72.23988, "t": 369.492, "r": 106.90548, "b": 356.208 }, "text": "Bovine", "attrs": { "row": 1, "col": 0, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.5", "order": 17, "type": "table_cell", "bbox": { "l": 213.84, "t": 369.552, "r": 361.92, "b": 341.424 }, "text": "5' GCCATATACTCTCCTTGGTGACA 3'5' GTAGGCTTGGGAATAGTACGA 3'", "attrs": { "row": 1, "col": 1, "rowspan": 1, "colspan": 1 } }, { "id": "p48.6.6", "order": 18, "type": "table_cell", "bbox": { "l": 423.6, "t": 369.492, "r": 456.6, "b": 356.208 }, "text": "271 bp", "attrs": { "row": 1, "col": 2, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.7", "order": 19, "type": "table_cell", "bbox": { "l": 72.23988, "t": 341.412, "r": 112.22868, "b": 328.128 }, "text": "Chicken", "attrs": { "row": 2, "col": 0, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.8", "order": 20, "type": "table_cell", "bbox": { "l": 213.84, "t": 341.424, "r": 361.92, "b": 313.296 }, "text": "5' GGGACACCCTCCCCCTTAATGACA 3'5' GGAGGGCTGGAAGAAGGAGTG 3'", "attrs": { "row": 2, "col": 1, "rowspan": 1, "colspan": 1 } }, { "id": "p48.6.9", "order": 21, "type": "table_cell", "bbox": { "l": 423.6, "t": 341.412, "r": 456.6, "b": 328.128 }, "text": "266 bp", "attrs": { "row": 2, "col": 2, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.10", "order": 22, "type": "table_cell", "bbox": { "l": 72.23988, "t": 313.332, "r": 108.89748, "b": 300.048 }, "text": "Porcine", "attrs": { "row": 3, "col": 0, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.11", "order": 23, "type": "table_cell", "bbox": { "l": 213.84, "t": 313.296, "r": 361.92, "b": 285.168 }, "text": "5' GCCTAAATCTCCCCTCAATGGTA 3'5' ATGAAAGAGGCAAATAGATTTTCG 3'", "attrs": { "row": 3, "col": 1, "rowspan": 1, "colspan": 1 } }, { "id": "p48.6.12", "order": 24, "type": "table_cell", "bbox": { "l": 423.6, "t": 313.332, "r": 456.6, "b": 300.048 }, "text": "212 bp", "attrs": { "row": 3, "col": 2, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.13", "order": 25, "type": "table_cell", "bbox": { "l": 72.23988, "t": 285.252, "r": 101.56788, "b": 271.96799999999996 }, "text": "Ovine", "attrs": { "row": 4, "col": 0, "rowspan": 1, "colspan": 1, "bbox_refit": true } }, { "id": "p48.6.14", "order": 26, "type": "table_cell", "bbox": { "l": 213.84, "t": 285.168, "r": 361.92, "b": 257.04 }, "text": "5' TTAAAGACTGAGAGCATGATA 3'5' ATGAAAGAGGCAAATAGATTTTCG 3'", "attrs": { "row": 4, "col": 1, "rowspan": 1, "colspan": 1 } }, { "id": "p48.6.15", "order": 27, "type": "table_cell", "bbox": { "l": 423.6, "t": 285.252, "r": 456.6, "b": 271.96799999999996 }, "text": "225 bp", "attrs": { "row": 4, "col": 2, "rowspan": 1, "colspan": 1, "bbox_refit": true } } ] }, { "id": "p48.7", "order": 28, "type": "heading", "bbox": { "l": 245.28, "t": 228.48, "r": 366.48, "b": 216 }, "text": "Results and Discussion", "attrs": { "block_label": "paragraph_title" }, "level": 3 }, { "id": "p48.8", "order": 29, "type": "text", "bbox": { "l": 68.64, "t": 207.6, "r": 543.12, "b": 110.64 }, "text": "In concern to primer testing, there was cross amplification across samples as well as non-specific results (Figure 1). This may be due to accidental cross-contamination, the primers were not specific enough, and/or the PCR parameters were not strict enough. Also, the annealing temperature of [p48.8.2]C resulted in amplified and non-specific results, so in the future this temperature can be further raised.", "children": [ { "id": "p48.8.1", "order": 30, "type": "form_field", "bbox": { "l": 416.83, "t": 207.6, "r": 428.83, "b": 195.6 }, "text": "", "attrs": { "field_kind": "radio", "label": "C resulted in amplified and non-specific results, so in the…", "source": "glyph_estimate", "bbox_estimated": true, "label_source": "parent_text", "label_ref": "p48.8", "text_offset": 3, "text_span": 0 } }, { "id": "p48.8.2", "order": 31, "type": "text", "bbox": { "l": 68.64, "t": 207.6, "r": 543.12, "b": 110.64 }, "text": "60^{\\circ}", "attrs": { "inline": true, "text_offset": 293, "text_span": 9, "bbox_estimated": true } } ] }, { "id": "p48.9", "order": 32, "type": "footer", "bbox": { "l": 298.8, "t": 60, "r": 313.92, "b": 50.16 }, "text": "44", "attrs": { "block_label": "number" } } ], "excluded_furniture": { "first": [], "last": [] } }